Yes you can please refer the link

https://www.qiagen.com/us/shop/assay-technologies/mirna/miscript-sybr-green-pcr-kit/

Yes Pannapa, i use both u6 and actin. Other house keeping genes whose expression patterns are not affected by variations in conditions can also be used.

If I order the U6 snRNA RT primer and forward / reverse primer for qPCR detection, What kind of SYBR can I use. I mean, it is necessary to be miScrip SYBR or the normal for real time PCR ?    

   thank you so much 

The normal SYBR should be ok since you are interested in detection of your U6 snRNA. However, if you intend to normalize the expression patterns of your miRNAs as well, then it will be advisable to go for miScrip SYBR. Because it contains ROX dye, which is absent in the  SYBR used for normal real time PCR.

ROX is not involved in the PCR reaction but Sybr green does and is normally used to detect PCR products.

Thank you very much everyone. I will try to  do the experiment by following your advice

:) 

I have used a SYBR-green based PCR assay, although it must be noted that it was using the biorad IQ supermix which may perform differently to home made mixes. You can avoid using ROX if you do a panel of reference genes. In fact, it would be wise to validate your reference gene unless others have shown that it is stable in your conditions. The following link may clarify some concepts

http://www.gene-quantification.de/hkg.html

@Pannapa Pinweha can you provide me the exact stem loop primer sequence and forward primer sequence of U6. Thanks alot.

Hello Kaur, I am not sure this sequence is useful or not in your experiment, but I used this to detect miRNAs.

U6snRNA stem-loop RT primer

GTGCAGGGTCCGAGGTTTTGGACCATTTCTCGAT

U6snRNA

for-ggaacgatacagagaagattagca

rev- gtgcagggtccgaggt