Can i do phenol-chlorform-iso amyl dna extraction on samples which had previously boiled for extraction but didnt have good results by nanodrop?

More fateme hoseinpour's questions See All

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

How to use CINPE4 elements in ABAQUS for infinite boundaries?

Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...

06 June 2024 448 4 View

How merge output files of simulation with NAMD?

I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...

19 May 2024 1,483 2 View

What is the reason of pattern of lithography in center of wafer are thicker in comparison of edges of the wafer?

Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...

22 April 2024 6,796 4 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

What is the role of surface tuxture in anti gravel coatings?

Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?

22 March 2024 7,758 0 View

Have you ever run a steered molecular dynamic simulation with NAMD?

Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?

05 March 2024 7,935 1 View

How can the bitter taste from calcium chloride treatment in a protein product be minimized while maintaining the desired texture?

Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...

24 February 2024 1,806 2 View

How could i minimize and equilibrate system with available output files of CHARMM-GUI for NAMD?

I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...

13 February 2024 4,182 0 View

Is there a problem with my RNA pellet?

Hello, I am currently having problems with RNA extraction. I am using mouse liver (C57BL6J), and I have extracted RNA from mouse liver before. Before this experiment, my final RNA pellets were...

11 August 2024 7,082 3 View

Can I base on reverse DNA sequences to perform alignment, convert to amino acids and GenBank submission?

I have reverse sequences (AB1 format), can I base on reverse DNA sequences to perform nucleotide alignment, convert nucleotides to amino acids and deposit the sequence in GenBank database?

11 August 2024 5,138 1 View

Strugglling with m6A dot blot any suugesstion ?

I have been doing the m6A dot blot for a while with no improvement, I am extracting the RNA, and I can see the dots although the three biological replicas give a different reading on the memberan...

10 August 2024 8,539 5 View

How can I use the cif data obtained from rietveld refinement extracted via gsas2, for microstructural analysis using ETEX software?

09 August 2024 7,718 0 View

RNA Extraction Using Hot Borate Method No Longer Working?

I've been performing RNA extraction on cotton petiole tissue for a few months now using the method described in the following paper, a derivative of the typical hot borate method...

08 August 2024 9,882 2 View

I can't see the ssDNA band after performing asymmetric PCR. Is there any way to do this?

After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...

08 August 2024 1,668 3 View

Does crude extraction using NaOH and Tris work well with Fungi?

I'm trying to find a DNA extraction method for fungi that does not require equipment and heating. Is there anyone who can suggest an alternative option? Thank you

08 August 2024 4,733 2 View

Microtome tissue sectioning - How to prevent chatter of paraffin tissue specimen sections?

Hello everyone, I have recently started using the microtome device for sectioning of paraffin-embedded mice lung. While I had some success in sectioning and observing proper ribbons, some of my...

06 August 2024 666 4 View

Are there instances where molecules with larger molecular weights exhibit greater mobility than those with smaller molecular weights?

Hi, I know that low molecular weight (MW) molecules generally tend to have higher mobility, while high molecular weight molecules tend to have lower mobility. However, in my experimental...

06 August 2024 1,495 2 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View