I’m planning to transduce EML cells, a murine multipotent hematopoietic cell line, with a lentiviral vector for ectopic expression of an oncogenic protein. I would like to inject them in mice to follow tumor progression, however I can’t find in the literature in vivo studies with this cell line. Since I'm not an expert in this field, I was wondering if there is any issue with using these cells for in vivo experiments.
Thanks in advance!
Dear Luisa!
Please You look at the following article:
Article AML1/ETO accelerates cell migration and impairs cell-to-cell...
Cell lines and vectors
EML cell line (EML Cell Line, Clone 1 ATCC® CRL-11691™), Kasumi-1, SKNO-1, AFT024 and 293T ecotropic cells were maintained in appropriate media as specified on the ATCC website.
EML-AE14 and EML-AE22 cell lines were generated by retroviral infection of EML cells with PINCO vector carrying full length AML1/ETO cDNA (PINCO-AE) or the control empty vector, and subsequent FACS sorting of GFP-positive cells. The EML PINCO-AE bulk population was subjected to serial dilution to select clones with high levels of AML1/ETO protein expression.
Kasumi-1 and SKNO-1 were infected with lentiviral pSICO vector expressing short interfering RNAs (shRNA) against the ETO moiety (cloned sequence: tgcaatgggatgtatgaattattcaggagatattcatacatcccattgcttttttc, where underlined portion is the target-specific sequence) and selected by puromycin treatment for 3 days (at a concentration respectively of 1 μg/mL and 7 μg/mL).
Mice
Experiments involving mice were performed in agreement with the guidelines reported in37 and according to the international and Italian law. All procedures in vivo have been approved by the Italian Ministry of Health (protocol numbers: IEO 10/2013, TOP 1/2011) and performed under the supervision of the Institutional Committee for Animal Welfare. Mice used in the study were purchased from Charles River Laboratories: C57BL6/Ly5.2 (strain C57BL/6NCrl), C57BL6/Ly5.1 (strain B6.SJL-PtprcaPepcb/BoyCrl), B6 Albino mice (strain B6N-Tyrc-Brd/BrdCrCrl), NOD/SCID mice (strain NOD.CB17-Prkdcscid/NcrCrl). AML1/ETO-Rosa26-eYFP-Rosa26-cre-ER Ly5.2, Rosa26-Cre-ER Ly5.2 and Ubi-Luc2 knock-in mice were bread locally (IEO and University of Milan). We used 8- to 12-week-old males and females (average weight - 20–25 g).
Dear Alexandr,
Many thanks for your reply! I have already read the article and I have seen that the authors injected EML cells into NOD/SCID mice and they analyzed bone marrow and spleens sixteen hours later. This is the only in vivo experiment in which EML cells are used. So I was wondering whether this cell line is also suitable for long term experiments.
Thank you again for your support!
Hi Louisa,
there is no direct evidence to support the idea of long term in vivo culture of the cell line. The cell line is sv40 positive and dependent on c-kit ligand.
In theory, you should be able to do this. the line is derived from a male BDF1 mouse. So to minimize the risk of rejection, I would use male BDF1 recipients and start by injecting 2E6 CFSE labeled cells into the lateral tail vein. If they can home to the bone marrow niche, then they should survive and you should be able to isolate CFSE labeled cells at a later time point.
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Cell Biology
- Culture Cells
- Cell Line