Contact experts in PCR Analysis to get answers
1,281 views 222 posts
Questions related to PCR Analysis
Hi! Recently started using a new genotyping kit for PCR and all of a sudden started seeing non-specific bands on the gel. At first I thought contamination, but I've tried all new primers and...
05 December 2015 961 2 View
I have run RT-PCR plate to test two primers on two diffrent cDNA (both at conc. of 500ng/microlitre) samples taken at diffrent times. The same concentration of primers (2.5micromolar) resulted...
03 December 2015 2,617 4 View
I already optimized methylation-specific PCR (MSP) and got results for 50 samples. However when I repeat it again using a new bisulfite treatment kit, I cannot get consistent band. Below are the...
30 November 2015 789 3 View
I'm currently trying to amplify circularized DNA. Only a small sequence of this circularized DNA is known and was used for Primer design. The other part of the circularized DNA is unknown genomic...
30 November 2015 4,910 6 View
Does anyone know why after extracting Cryptosporidium DNA from feacal samples, the first PCR works well but when I need to run another PCR from the same extracted DNA, it does not work on gel...
28 November 2015 3,972 4 View
I have crushed up woodlice, serial diluted and spread plated and have growth of fungus on SDA+antibiotics. I have also done a DNA extraction and run PCR with fungal primers, bacterial primers and...
25 November 2015 4,086 6 View
This an image of one of the PCR results received with the named problem of inconsistent band brightens.
13 November 2015 5,780 2 View
hello, can any one help me, i have this problem where my NTC and RT- give me the same band size and length of template as my sample when i run the gel after the my Taq- PCR?
11 November 2015 4,171 1 View
My PCR's suddenly stopped working a few weeks back, and I can't figure out what is wrong. Attached is a photo of my gel and you can see the segments of smearing which is much larger than my...
11 November 2015 3,570 6 View
11 November 2015 7,880 7 View
11 November 2015 6,211 3 View
11 November 2015 6,402 5 View
This is a mission shRNA library retrieve PCR process. The given primer in the kit called LAP1 and LAP2 product is 342bp, which is too large to proceed the PE150 illumina sequencing. So I...
11 November 2015 1,692 0 View
11 November 2015 4,519 2 View
For TD PCR, it's recommended that Ta be 10°C higher than the normal cycling Ta for the first 10 cycles or so, dropping 0.5 to 1.0°C/cycle. Should the extension temperature match this pattern to...
11 November 2015 4,856 3 View
Knowing the first line from right side it is negative control and the second line for internal control and third line for positive control? and we have also in my kits * HPV-267-325 bP* Internal...
11 November 2015 4,394 2 View
I did a 2nd PCR to amplify the PCR products from first PCR I did. The first PCR products are in lanes 3 and 4. The product bands are quite light but still there. There are two bands underneath the...
11 November 2015 2,917 5 View
How can I separate well two PCR bands close to each other, in order to cut my target band and clone a target gene (1800bp) ?
11 November 2015 9,135 5 View
this is a genusspecific pcr, with primers for the S. aureus in lane 2 and 3 (2 being the negative control that is positive). In lane 4 and 5 are the used primers for S. epidermidis. Lane 4...
06 November 2015 7,587 2 View
03 November 2015 6,344 1 View
Hi, I want to ask why don,t we use PCR product directly in cloning, why we prefer to extract DNA in every step? Secondly when ever i extract DNA from gel its concentration is very low, around...
30 October 2015 2,631 14 View
I have a set of samples and I performed qPCR to check the level of my transcript of interest. Now I have a series of Relative Expression data and I want to identify a cut off above which the...
28 October 2015 1,570 7 View
I amplified a gene(np gene of TSWV) form total RNA. total RNA was extracted from leaf of tobacco. I had used these primer pair: F : ATGTCTAAGGTTAAGCTCACTA R : TTAAGCAAGTTCTGTGAGTT these primer...
26 October 2015 3,097 8 View
I've been having trouble with a PCR reaction. I ran two PCRs with the same DNA samples, the only different being the primers. The first PCR (labeled Zip14 WT) worked fine. The second PCR (labeled...
23 October 2015 825 11 View