I amplified a gene(np gene of TSWV) form total RNA.
total RNA was extracted from leaf of tobacco.
I had used these primer pair:
F : ATGTCTAAGGTTAAGCTCACTA
R : TTAAGCAAGTTCTGTGAGTT
these primer pair amplify 777 bp pcr product.
I had checked these primers in "Primer Blast". primers was specific for TSWV.
but my pcr product is about 500 bp.
what is there problem, why pcr product is not 777 bp?
the pcr cycle was:
94 --- 94 51 70 X35 --- 70
3:00 ---0:30 0:30 1:00 ---- 10:00
I had used Red Master Mix from Ampilicon.
Dear Dr. Musa,
Despite being OK in BLAST, your PCR primers are repeatedly giving a smaller size amplicon. I suggest you to go for direct sequencing of the 500 bp amplicons with the same primer pairs or you can also clone and sequence with vector primers. Blast the sequence and check if there are any deletions in your virus isolate, or if correct target of the virus genome is being amplified.
hope you get success..
SD
the PCR condition seems good but if you are sure about your primers, you can try these steps:
1- increase the amount of dNTPs around 20%
2- increase annealing temprature 2-5 degree
3- increase extention time to 80s
you can also decrease Mgcl2 amount to prevent non specific bands.
if it is possible for you, use hot start taq master mixes.
good luck
hi,
Your PCR condition is seems OK and you can prepare your reaction mixture as suggested by Marziyeh S.Jahromi.
if again same problem is coming than you have to change your annealing temperature because sometimes due to annealing temperature, non specific products are found. So, you can try by changing your annealing temperature.
and if similar results is again coming than you can purify the products and clone it and go for sequencing and see what is the results because sometimes if any genes is presents in the inverted position it is giving that type of result which you are currently facing.
Good Luck.
Dear Dr. Musa,
Despite being OK in BLAST, your PCR primers are repeatedly giving a smaller size amplicon. I suggest you to go for direct sequencing of the 500 bp amplicons with the same primer pairs or you can also clone and sequence with vector primers. Blast the sequence and check if there are any deletions in your virus isolate, or if correct target of the virus genome is being amplified.
hope you get success..
SD
did you primer blast only against the virus tswv genome ?
Is there homology with the Tobacco genome ( blast search to include repeat sequences )which is amplifying.?Many repeat sequences in genomes have similarity with viral genomes. Sibnaryan is right that the sequence of the amplimer should identify the problem but increasing the annealing temperature as suggested above seems worth a try as does re amplifying with nested primers in case there is a small amount of the correct product present but not visible
Paul is correct. You must also check the primers against tobacco genome. you can search the GenBank against 'nr' database and also with 'somewhat similar sequences' parameter to be sure.
Make sure your RNA extraction for virus. Did you use cDNA as the templet ? And is there any other bands in your amplification? Then you can sequence your product to see if it is a virus sequence or just a sequence from plants.
- Badges
- Science method