Just for reference, here is the heterodimer. The 3' complementarity is really not a pretty sight to behold.
Delta G: -6.78 kcal/mole Base Pairs: 4
5' GGCGGGAATTCGTTCGTGTGCTCG
| | | |
3' GGAGCAGTCGATTAACGCCGGCGA
Hi Kelli,
I'm using this primer set to amplify a particular bacterial gene from its genome.
The Tm of primer pair is 14 degree of centigrade and then it cant make problem in PCR but it may reduce PCR efficiency.
I wouldn't use this primer set if I had a choice. (I use a cutoff of -5.6)But If you are asking this you probably don't have many other options. But maybe you could make them shorter. A 18 nt primer works also fine in most normal PCR's.
Hi Mariel
I see, but does the 18 nt primers include restriction enzyme sites?
Thanks.
Is restriction site in your interest fragment or you added it in your primers? if it is not in your interest fragment increase the primer size. (in first primer (if you added restriction site) you have only 13 match nucleotide that its tm is about 42)
I've had good results with primers that have 16nt complementary to the target (so that is without the restriction site and the extra nucl needed)
- Badges
- Science method