10 Questions 12 Answers 0 Followers
Questions related from Avin Ee-Hwan Koh
If I were to use a certain volume of mycobacterial culture (atypical mycobacteria) directly from a liquid broth and subject it to conventional DNA extraction kit protocols using silica membrane...
04 April 2015 5,085 8 View
I amplified my gene of interest via PCR, and had it sequenced. Surprisingly, there is a single base deletion within the sequence. I'm pretty sure it shouldn't be there, at least based on the...
12 December 2014 2,505 10 View
I amplified my gene of interest using a set of primers and PCR, then I had it sent to get sequenced (dye-terminator). Lo and behold, it was the gene that I was expecting. However, I could not find...
12 December 2014 7,253 19 View
Should I purify my ligation mixture before transforming the competent cells? Or would I be able to directly use the mixture, but suffer from a reduction in transformation efficiency instead?
11 November 2014 8,768 4 View
Just for reference, here is the heterodimer. The 3' complementarity is really not a pretty sight to behold. Delta G: -6.78 kcal/mole Base Pairs: 4 5' GGCGGGAATTCGTTCGTGTGCTCG ...
11 November 2014 6,072 6 View
Am I supposed to first design my primers to get the closest matching Tm and then add in the restriction sites afterwards, or are the restriction sites supposed to be added to my primers first...
10 October 2014 665 12 View
Would the PCR reaction be hindered if my primers can form secondary structures at a temperature that is close to the primers' melting temperature? Since the temperature difference is small, the...
10 October 2014 860 12 View
The primers that I designed initially had Tm values of 54.26°C (Fwd primer) and 45.53°C (Rev primer) before I added the restriction sites. After I did that, however, I managed to get the Tm...
10 October 2014 7,204 18 View
The prokaryotic gene I'm looking at has conserved DNA sequences/ sequence motifs, but do not inlcude the start and stop codons within them although the motifs are part of the CDS. So if I were to...
10 October 2014 2,661 13 View
If the concentration of EDTA (0.5 M) in 10x TAE buffer is increased, will it affect gel electrophoresis and consequently, the DNA bands when I use my 1x working solution? E.g. 0.7 M, 0.8 M, etc.
10 October 2014 4,190 5 View