Avin Ee-Hwan Koh

10 Questions 12 Answers 0 Followers

Questions related from Avin Ee-Hwan Koh

Are conventional silica membrane spin columns effective in extracting mycobacterial genomic DNA if the cells weren't treated first with e.g. boiling?

If I were to use a certain volume of mycobacterial culture (atypical mycobacteria) directly from a liquid broth and subject it to conventional DNA extraction kit protocols using silica membrane...

04 April 2015 4,951 8 View

Can there be single base deletions due to PCR?

I amplified my gene of interest via PCR, and had it sequenced. Surprisingly, there is a single base deletion within the sequence. I'm pretty sure it shouldn't be there, at least based on the...

12 December 2014 2,363 10 View

In the case of sequencing, is it normal for a chromatogram to show a shortened gene sequence when I'm actually expecting a full-length sequence?

I amplified my gene of interest using a set of primers and PCR, then I had it sent to get sequenced (dye-terminator). Lo and behold, it was the gene that I was expecting. However, I could not find...

12 December 2014 7,146 19 View

Is it preferable/necessary to purify my ligation mixture before the transformation step?

Should I purify my ligation mixture before transforming the competent cells? Or would I be able to directly use the mixture, but suffer from a reduction in transformation efficiency instead?

11 November 2014 8,620 4 View

Will a heterodimer of dG -6.78 kcal/mole be a problem?

Just for reference, here is the heterodimer. The 3' complementarity is really not a pretty sight to behold. Delta G: -6.78 kcal/mole Base Pairs: 4 5' GGCGGGAATTCGTTCGTGTGCTCG ...

11 November 2014 5,950 6 View

Should I calculate the Tm for my primers before adding in the 5' restriction sites or after?

Am I supposed to first design my primers to get the closest matching Tm and then add in the restriction sites afterwards, or are the restriction sites supposed to be added to my primers first...

10 October 2014 495 12 View

Is it bad if the strongest folding Tm (secondary structure) of my primers are closely similar to that of my primers' Tm?

Would the PCR reaction be hindered if my primers can form secondary structures at a temperature that is close to the primers' melting temperature? Since the temperature difference is small, the...

10 October 2014 661 12 View

Before adding the restriction sites, my primers have a 9°C Tm difference but after adding them, the Tm values narrowed. How does this affect my PCR?

The primers that I designed initially had Tm values of 54.26°C (Fwd primer) and 45.53°C (Rev primer) before I added the restriction sites. After I did that, however, I managed to get the Tm...

10 October 2014 7,078 18 View

If I were to clone a gene for expression studies, should I clone the full length gene or just the CDS (with/without the start and stop codons)?

The prokaryotic gene I'm looking at has conserved DNA sequences/ sequence motifs, but do not inlcude the start and stop codons within them although the motifs are part of the CDS. So if I were to...

10 October 2014 2,487 13 View

Will the agarose gel electrophoresis be affected by higher concentrations of EDTA in my TAE buffer?

If the concentration of EDTA (0.5 M) in 10x TAE buffer is increased, will it affect gel electrophoresis and consequently, the DNA bands when I use my 1x working solution? E.g. 0.7 M, 0.8 M, etc.

10 October 2014 4,014 5 View