I am an RA doing site-directed mutation in an 8.5kb plasmid; we use the Q5® Site-Directed Mutagenesis Kit from Biolab. I designed my primers in their tool Nebasechanger and followed every step in their protocol; however, while my final product should be an 8.5kb plasmid with mutation(substitution), there is only a 4kb product in the gel. I just find it really hard to understand.
Is there anybody with the same experience or who has used the same kit who can help me? thank you！
Have you checked that you have correct plasmid (the one you want to mutate)? When you do single digest, do you see nice single band of proper size?
It would be good to see some more details such as primer sequences, plasmid map, protocol steps etc.
Hi Tomáš, thanks for your answer!
It is unlikely that we used the wrong plasmid, and I did not single-digest the product. But I seed them on the plate, and not even one colony showed up. Attached are the plasmid map and primer sequences.
As the kit indicate, I add 12.5ul Q5 enzyme, 1.25ul R and 1.25ul F primer, 20ng template, and 9ul water for a total 25 ul system.
And I set the PCR procedure as
98 degrees 30 seconds
25cycles of
98 10 seconds
69 30 seconds
72 4.5min
and a final 2 min for 72 degrees
I was wondering if Biolab's primer design tool is reliable.
Tomáš Hluska
What do you mean by "I seed them on the plate"?
I'd try the digest anyway. It's the easiest way to check at least in a crude way, that your plasmid is OK.
I am a little confused now. I checked the primers and if what you shared is the complete sequence, I don't see, what is the point? The overhangs are not homologous to each other, neither to the plasmid. What exactly are you trying to do? Is it deletion of the nucleotides in yellow? Or replace it with the overhangs?
With these primers you should get linear amplicon, but the bacteria will have to ligate it once it is transformed (which should work in theory, but some overhangs would be better).
Your template seems to have high GC content, so maybe try to include the Q5 High GC Enhancer, if you have. If not, try other additives such as DMSO or betaine.
I'd try to design primers either for the resistence gene (AmpR) or ori, which would yield overlapping sequences, when used with your primers. E.g. I have used the following primers:
>ori_fw
AAGAACTCTGTAGCACCGCC
>ori_rev
ATCGTCTTGAGTCCAACCCG
You'd use 1 ori primer with 1 of your primers (depending on their relative orientation) to amplify both halves of your plasmid and then mixing these and amplify them again to yield your plasmid.
Your annealing temperature seems a bit high especially if you have a mismatch.
Also be sure your transformation is working well, even if all the conditions are correct but transformation efficiency is low, then you are likely to fail to get colonies.
Tomáš Hluska
Sorry for the misunderstanding; seed the plate means transformation and getting colonies.
And yes, I am trying to replace the original sequence with those overhangs, and the primers used in this experiment should never be overlapped, as Biolab, the company that made this kit, specifically mentioned.
"Your template seems to have high GC content, so maybe try to include the Q5 High GC Enhancer"
thank you, this is a new point! I will do some more search about this.
"I'd try to design primers either for the resistence gene (AmpR) or ori, which would yield overlapping sequences, when used with your primers."
I am also considering this; it is hard to understand why we have to use not-overlapped primers when using the Biolab kit. But I guess I still need to ask the technical support of the company.
Thank you!
Michael J. Benedik the Ta is high, but it corresponds to the annealing part of primers. It is temperature recommended by NEB. I have checked it as well.
Luqi Chen I checked the kit now and you're supposed to do ligation, hence you must not have overlaps.
Did you get zero colonies also with the original plasmid? If that is the case, something is terribly wrong either with the plasmid, or with your transformation protocol.
If you'd be interested, I can help you design new primers and clone your plasmid.
Anyway, first thing first, you should check your original plasmid, because at the moment, the problem seems to be with the PCR, as you get only "small" fragment.
I was having issues some time ago and we found out that for our template in special we needed to increase denaturation and extension time beyond the values given by the manufacturer. Also, if the primers are tricky to design because of the mutations you are including or the sequence, I usually run two separate reactions with each primer, run it for 7 cycles without final extension, mix 50/50 and continue the rest of the cycles + final extension. After adjusting that it works like a charm for us: we get our band and we get what we need with the first clones we pick.
Tomáš Hluska Thanks for your answer! My colleagues and I finally found out that there is another non-specific binding site for our primer within the target gene, and it is a problem without a solution, so we decide to use another method. Just cut off the tiny fragment of DNA containing the mutation site but not the non-specific binding site within the target gene and reinsert them into the target gene after mutation. Wish that would work. Otherwise, we have to let the company synthesise the target gene by its sequence.
Well, you could do phusion PCR, where you will amplify beginning of your gene, end of your gene and then combine them to produce the full length sequence.
- Badges
- Science topic