I performed mutagenesis by PCR and I got a single band successfully. Then the PCR product was purified from the gel and transformed to DH5α. I picked up 6 colonies and purified the plasmid.
However, some unexpected insertions were found in these plasmids after sequencing and these insertions are 2 repeats of my primer. Should I reduce the primer concentration in the PCR reaction? Or anyone has other advice?
Here is my primer:
F: 5'- GTCTTGGTACAAGGAAAAAGAAAAGA -3'
R: 5'- TCTTTTCTTTTTCCTTGTACCAAGAC -3'
PCR condition in 50µl reaction system:
- KOD One PCR Master Mix from TOYOBO 25 µl
- 10 µM F primer 1.5 µl
- 10 µM R primer 1.5 µl
- 50 ng/µl plasmid 1µl
- SDW 21µl
98 ℃ for 10s, 60 ℃ for 5s, 68 ℃ for 1min 40s, 30 cycles
Wayhu Handoko is right. We need more information. My first impression is that you tried to design a primer and the reverse complement. In this case the lower primer should be: 5'- TCTTTTCTTTTTCCTTGTACCAAGAC -3' and not R: 3'- TCTTTTCTTTTTCCTTGTACCAAGAC -5' .
Uwe
- Badges
- Science method