Why Error in the file of energy at td=(nstates=20) rb3lyp/6-31g(d,p) scrf=(iefpcm,solvent=toluene) geo m=connectivity?

Hafsah Nadeem @Hafsah-Nadeem

24 January 2024 0 2K Report

The error in log file is:

80 initial guesses have been made.

Convergence on wavefunction: 0.001000000000000

Davidson Disk Diagonalization: ConvIn= 1.00D-03 SkipCon=T Conv= 1.00D-03.

Max sub-space: 2000 roots to seek: 80 dimension of matrix: 1390572

Iteration 1 Dimension 80 NMult 0 NNew 80

AlAXAO: NMat= 80 NPMax= 9 NPMax1= 0 MaxMat= 0 Max3X=F NPAlg=2.

402625231 words are not enough for AlAXAO.

What is the solution to this?

Badges
Science topic

Similar topics
Vectorization

More Hafsah Nadeem's questions See All

How can I find the cracked version of ENVI-met software?

Envi-met software

07 August 2024 8,188 1 View

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

How far medical science reached in the treatment of diabetes type 2 ?

Is it possible to cure diabetes clinically? There are huge number of diabetes patients around the world. what are the main causes of this medical conditionand what about history of diabetes. when...

01 March 2024 6,084 7 View

QSPR model is not fit for or it does not deliberate best answers. How we can improve it?

The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.

29 August 2023 7,764 2 View

What the difference exists between the QSPR analysis by using 2D and 3D model of drugs structures?

Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?

27 August 2023 552 2 View

How do I replace a file with a more recent version of a paper that was uploaded to ResearchGate?

The paper in question is "Interpolation of Nitrogen Fertilizer Use in Canada from Fertilizer Use Surveys". This paper was very recently published by Agronomy (MDPI). Agronomy has, in the last day...

07 August 2024 9,934 3 View

How to solve g_mmpbsa error?

Program: g_mmpbsa, version 2024.1 Source file: extrn_apbs.cxx (line 152) Fatal error: Failed to execute command: $APBS pybYcUWA.in --output-file=pybYcUW.out

07 August 2024 6,066 0 View

What is the solvent for 8YSZ nano material?

I need to do some experiment with it in liquid form.

07 August 2024 613 3 View

How do you delete a duplicate pdf for the same paper on ResearchGate?

The first pdf file I uploaded had an error. So I uploaded an updated, corrected pdf of that paper with a different pdf name. I dpon't want the old copy to be download or read.

07 August 2024 9,508 1 View

AUX gas reading problem on QE with full MS and PRM method in one run?

Dear QE-users, In the method where full MS positive mode and PRM mode are used, we always get an incorrect auxiliary gas reading (41 instead of 25). This only happens in this method; other...

06 August 2024 4,953 0 View

JCPDS 65-7246 file please?

Dear Researchers Kindly share JCPDS 65-7246 file Thanks in advance

04 August 2024 5,613 1 View

Dirty and clean?

Hi everyone I need a file with a dirty and clean potato image

04 August 2024 7,199 4 View

Which solvent is better to dissolve with secondary metabolites extracted from fungi?

I work on MCF7 cell cell for anticaner purpose and I wa to do drug preperation the drug ( secondary metabolites extracted from Aspergillus) My question which solvent is better with these secodary...

03 August 2024 4,725 2 View

I need to dissolve stigmasterol for an animal experiment, it hasn't dissolved in either DMSO or vegetable oil. Can anyone recommend the best solvent?

Hello everyone, I need to dissolve stigmasterol for an animal experiment, but it hasn't dissolved in either DMSO or vegetable oil. Can anyone recommend the best solvent for stigmasterol?

01 August 2024 7,504 2 View

How to back transform the results generated from analyses using log transformed with In(X+1) data?

I am conducting my analysis using SPSS. I log transformed my data using In(X+1) as my data contain zero values. However, when I want to back transform the regression coefficients generated from my...

31 July 2024 7,860 3 View