Hi guys,

I'm trying to find a short sequence which has SNP in the original gene sequence. But I can't find any match at all in the gene sequence, not even a small fragment.

SNP sequence:

TCGGCATCCTGACTACATTGATACT[A/G]GTCCCAACTATTGACATATATAGCT

Original gene: LOC105046100

Anyone have any idea why?

More Lim Wan Wan's questions See All
Similar questions and discussions