Hi, I am really in trouble, I spend almost 3 months on constructing C Terminal vector with 4 MYC but always after sequencing and alignment i get wrong in MYC sequence, some mutations. MYC sequence is alright . Actually i clone MYC from pAHC25 VECTOR AND TRANSFORMED INTO pCUBI1390 over expression vector, but when ever i transformed my gene of interest and MYC together into T vector, i get wrong result, What should I do, I dont want to waste my time any more, please give me some suggestion as soon as possible. I attatch vector containing MYC and also myc seq. Thanks
What is the length of the insert? What is the distance from the primer to your sequence? How is the sequence read quality?
Are you using proof reading enzymes or a blend to amplify your fragment?
Maybe MYC is toxic for the host and therefor only mutants are stably expressed.
What type of mutations do you get and how many and where are they in your sequence?
Frame shifT mutation, 2 mutation in my gene of interest and 2 in MYC , so thats why i am afraid is it effect translation of fuse protein?
You could try to use a mutagenesis kit to repair the 4 mutations, this will be a lot of work for 4 different mutations, but we offen do this.
Have you sequence confirmed your starting plasmid? It happens more than you think that a plasmid that you get isn't correct in some way.
First of all i cloned my gene of interest by PCR, by designing primers have SpeI restriction site, and same in case of 4*MYC ( Actually it is 6 MYC in construct but i select only 4 copies). Then i fuse both 4* MYC & my gene of interest by PCR using prime star ingredients and ligate into blunt end T vector, then transform into e.coli but after sequencing alot of mutations come.
4*MYC seq:
AAAGCTATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGAGCTTGGGCGACCTCACCTGA
MYC Forward SpeI: AAAGCTATGGAGCAAAAGCTC
MYC REVERSE SpeI: CATA ACTAGT TCAGGTGAGGTCGCCCAAGCT
(4 nts) (SpeI)
Actually i clone both my gene of interest and 4 myc separetely. I did not clone my gene of interest at 5 end of myc.I just used primers have speI restriction sites for both gebe and myc cloning
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Molecular Methods
- Cloning