I have done semi quantitative RT PCR of my cDNA using TNF alpha and akt1 gene specific primers. The melting temperature of TNF alpha and akt1 primers according to data sheet given after primer synthesis is 58 deg and 57 deg respectively. I have tried gradient PCR from 54 deg to 64 deg but still i got the same results as shown in the gel picture. However, gapdh primers show single band as internal control. I have checked my primers specificity using Primer BLAST and they bind to desired template. Still, after repeated trials I'm not able to understand where I'm doing mistake. Please help!!!!
TNF alpha primers
Forward: agcactgaaagcatgatccggg
Reverse: gggtttgctacaacatgggctaca
akt1primers:
forward: AGCGACGTGGCTATTGTGAAG
reverse: CTCACGTTGGTCCACATCCTG
Seems like you have very high dna bands when amplifying TNF, may you have genomic dna contamination, do you have negative control (not adding template)?
Also, when you check specificity in Primer Blast, do you have partial complementarity to any other gene/isoforms? You can also limit annealing timte/temperature in the pcr to have only desired hybridations.
I wonder if you have some secondary structure problems. I would try running a dmso gradient from 1% to 8% final concentration dmso as this often cleans up multiple banding problems
Did you try confirming the primers to be sure it's specific? I will advice you try running an Insilico using uscsc database to be sure if the primer pairs are specific. I think if they aren't specific you will probably keep on getting multiple bands.
- Badges
- Science method