I have done semi quantitative RT PCR of my cDNA using TNF alpha and akt1 gene specific primers. The melting temperature of TNF alpha and akt1 primers according to data sheet given after primer synthesis is 58 deg and 57 deg respectively. I have tried gradient PCR from 54 deg to 64 deg but still i got the same results as shown in the gel picture. However, gapdh primers show single band as internal control. I have checked my primers specificity using Primer BLAST and they bind to desired template. Still, after repeated trials I'm not able to understand where I'm doing mistake. Please help!!!!
TNF alpha primers
Forward: agcactgaaagcatgatccggg
Reverse: gggtttgctacaacatgggctaca
akt1primers:
forward: AGCGACGTGGCTATTGTGAAG
reverse: CTCACGTTGGTCCACATCCTG