Hi there,
I'm trying to design primers to detect CRISPR-mediated KO using qPCR (as described in this paper: Article A qPCR method for genome editing efficiency determination an...
).I designed a few pairs of primers and neither of them show any signs of amplification.
As an example, this is a pair targeting the ITGA2 gene (exon 2):
Primer_FWD ("watching"): ATTGTTGTTTGGCCTACAATGTTG (target +/ 53026780)
Primer_REV: CTGCATAGCCAAACTGTTCACT (target -/ 53026816)
I used the following transcript for the design:
Imported from genome: GRCh38 (hg38, Homo sapiens)
Gene: ITGA2 (ENSG00000164171)
Location: chr5 52989326-53094779
Transcript: ITGA2-001 (ENST00000296585, CCDS3957)
This specific pair is a little low on GC%, but others have GC% within the recommended 40-60% range. However, neither primers seem to be working.
Apart from GC%, these primers comply with the recommendations for PCR primer design published on various websites. Yet, something isn't right - on qPCR amplification curves are dead flat after 40 cycles (I've tried a few template concentrations and annealing temperatures with no success).
Would anyone have some suggestions on what I do wrong? And what can I try?
Thank you in advance.
Perform a gradient PCR and use the annealing temperature that results in a good, intense band for qPCR.
Hi Oleg
performing in silico PCR on UCSC, your primers did well perform amplification at the good position. issues are therefore not coming for the primers (see attachment). maybe you could try a touch-down PCR in a range of 10°c and add some DMSO to get more accessible target.
all the best
fred
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Cell Biology
- Culture Cells
- Cell Line