I am using universal primers (Forward primer 5'- AGAGTTTGATCCTGGCTCAG -3' and reverse primer 5'- CTTGTGCGGGCCCCCGTCAATTC-3')
The most common bp lengths in GeneBank are 460-569 bp, we use sligthly different primers and get products around 506 bp.
05 June 2016 1,742 8 View
Can anybody suggest me exact analysis of neighbor joining dendrogram of bacterial population? In this regards file attached.
05 June 2016 8,754 2 View
I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...
03 March 2021 8,066 4 View
Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...
02 March 2021 4,029 3 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...
01 March 2021 8,544 1 View
I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...
01 March 2021 360 7 View
To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...
01 March 2021 8,683 4 View
Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?
01 March 2021 5,311 1 View
I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...
28 February 2021 606 3 View
hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?
28 February 2021 1,254 3 View
Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.
28 February 2021 5,008 4 View