I am using universal primers (Forward primer 5'- AGAGTTTGATCCTGGCTCAG -3' and reverse primer 5'- CTTGTGCGGGCCCCCGTCAATTC-3')
The most common bp lengths in GeneBank are 460-569 bp, we use sligthly different primers and get products around 506 bp.
I used a 16s rRNA universal primer for identification of unknown bacteria . Is it possible to identify bacteria as the PCR product size near 1000 bases, because 16s rRNA gene is of 1500 base?
05 June 2016 1,808 8 View
Can anybody suggest me exact analysis of neighbor joining dendrogram of bacterial population? In this regards file attached.
05 June 2016 8,857 2 View
I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...
08 August 2024 4,645 2 View
After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...
08 August 2024 1,668 3 View
i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...
05 August 2024 8,835 1 View
I want to introduce a point mutation (change in one nucleotide) into my gene of interest (DNA binding domain) I have designed primers as recommended on the Data sheet of the kit : -Both primers...
05 August 2024 9,059 3 View
How to design VN primer to attach with universal reverse primer
05 August 2024 2,116 3 View
I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...
01 August 2024 2,079 0 View
It's an end-point PCR protocol. I'm using 1.5% agarose gel with SyBR Safe dye and TBE as a running buffer, visualization on BioRad XR+ system. I was primarily thinking of primer efficiency,...
01 August 2024 4,673 4 View
Hello everyone, I performed a PCR yesterday, and the results showed no bands on the gel. Of course, I probably missed some crucial steps, like adding my samples to the PCR strips themselves, for...
31 July 2024 2,406 6 View
Can anyone with an MJ research / BioRad PCR machine from ~2010 or earlier tell me the external measurements (LxWxH) of the removable standard PCR alpha modules that can be removed from a PTC200 or...
30 July 2024 2,867 0 View
Hello all, I have been trying to follow a 2-stage PCR protocol used to amplify barcodes of a large yeast library, as per Nyugen et al. (2022) -...
30 July 2024 841 2 View