3 Questions 3 Answers 0 Followers
Questions related from Amit Pande
I am using universal primers (Forward primer 5'- AGAGTTTGATCCTGGCTCAG -3' and reverse primer 5'- CTTGTGCGGGCCCCCGTCAATTC-3')
06 June 2016 5,595 1 View
I used a 16s rRNA universal primer for identification of unknown bacteria . Is it possible to identify bacteria as the PCR product size near 1000 bases, because 16s rRNA gene is of 1500 base?
06 June 2016 1,857 8 View
Can anybody suggest me exact analysis of neighbor joining dendrogram of bacterial population? In this regards file attached.
06 June 2016 8,908 2 View