Amit Pande

3 Questions 3 Answers 0 Followers

Questions related from Amit Pande

What would the molecular size of the PCR product for the 16S rRNA?

I am using universal primers (Forward primer 5'- AGAGTTTGATCCTGGCTCAG -3' and reverse primer 5'- CTTGTGCGGGCCCCCGTCAATTC-3')

06 June 2016 5,517 1 View

Can I carry out identification of bacteria through 16s rRNA sequencing?

I used a 16s rRNA universal primer for identification of unknown bacteria . Is it possible to identify bacteria as the PCR product size near 1000 bases, because 16s rRNA gene is of 1500 base?

06 June 2016 1,784 8 View

Can anybody suggest me exact analysis of neighbor joining dendrogram of bacterial population?

Can anybody suggest me exact analysis of neighbor joining dendrogram of bacterial population? In this regards file attached.

06 June 2016 8,815 2 View