What would the molecular size of the PCR product for the 16S rRNA?

I am using universal primers (Forward primer 5'- AGAGTTTGATCCTGGCTCAG -3' and reverse primer 5'- CTTGTGCGGGCCCCCGTCAATTC-3')

05 June 2016 5,448 1 View

Can I carry out identification of bacteria through 16s rRNA sequencing?

05 June 2016 1,742 8 View

How to compare two groups with only two measurements?

Hiiiii everyone! I have an enquiry on statistical analysis. I was looking for many forum and it's still cannot solve my problem. I want to compare means of two groups of data but only with two...

03 March 2021 8,796 3 View

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

What kind of fluid could I use for a pitfall trap that also does not invalidate molecular testing?

Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...

03 March 2021 5,978 5 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

Do we need to write protocol for a second study of a systematic review that has been registered and published?

I have conducted and published a systematic review and meta-analysis research with the topic related to public health and health pomotion (protocol was registed in PROSPERO). Now we want to...

03 March 2021 8,920 3 View

How to increase a model accuracy ?

dear community, my model is based feature extraction from non stationary signals using discrete Wavelet Transform and then using statistical features then machine learning classifiers in order to...

03 March 2021 6,994 5 View

Do I need to do linear regression before running mediation analysis using PROCESS MACRO by Hayes ?

I just wanted to check if I need to run a linear regression separately if I am using PROCESS MACRO to run mediation analysis. Thank you.

02 March 2021 4,359 3 View

Sample dilution for quantitative analysis using ELISA?

If the detection range is in ng/ml but the reference range is in ug/ml for a molecule or protein in serum or plasma .how to dilute and what is the initial volume to be taken for quantitative analysis

02 March 2021 7,670 3 View

Is There Any Feasible Method To Test Fluorescent Compounds Other Than Fluorescence Spectrometers ??

Is There Any Feasible Method To Test The Efficiency Of Fluorescent Compounds Other Than UV Spectrometers ? Suggestions Would Be Appreciated !

02 March 2021 5,785 3 View

How to calculate average trend in maximum annual NDVI from MODIS?

I am wanting to calculate the average trend in maximum annual NDVI in Iceland from 2010-2020 using MODIS MYD13Q1 V6. How would I do this? I have currently inserted the NDVI bands from the MODIS...

02 March 2021 752 2 View