Can anybody suggest me exact analysis of neighbor joining dendrogram of bacterial population?

More Amit Pande's questions See All

What would the molecular size of the PCR product for the 16S rRNA?

I am using universal primers (Forward primer 5'- AGAGTTTGATCCTGGCTCAG -3' and reverse primer 5'- CTTGTGCGGGCCCCCGTCAATTC-3')

05 June 2016 5,540 1 View

Can I carry out identification of bacteria through 16s rRNA sequencing?

I used a 16s rRNA universal primer for identification of unknown bacteria . Is it possible to identify bacteria as the PCR product size near 1000 bases, because 16s rRNA gene is of 1500 base?

05 June 2016 1,808 8 View

How to learn more about SPSS and its Application?

I would like to learn more about SPSS and Its application especially in regards to data analysis. Please suggest me how I can learn more about it. Thank you so much.

11 August 2024 9,101 4 View

Can I base on reverse DNA sequences to perform alignment, convert to amino acids and GenBank submission?

I have reverse sequences (AB1 format), can I base on reverse DNA sequences to perform nucleotide alignment, convert nucleotides to amino acids and deposit the sequence in GenBank database?

11 August 2024 5,138 1 View

Baseline drift in HPLC? What causes this?

Hello, Why do i see this baseline drift when i compare my blank (black) to the sample (blue)? Any suggestions as to why this happened? Thank you!

11 August 2024 3,770 4 View

Text-Communication from the M1 Hand Area using BCI—and then there is Elon Musk?

Willett, Shenoy et al. (2021) have developed a brain computer interface (BCI) that used neural signal collected from the hand area of the motor cortex (area M1) of a paralyzed patient. The...

10 August 2024 7,180 0 View

Has anyone applied Python in the field of textile engineering for data analysis, automation, or smart textiles?

I'm currently exploring the application of Python in textile engineering, specifically in areas like data analysis, process automation, and the development of smart textiles. I'm interested in...

10 August 2024 7,429 2 View

How can I use the cif data obtained from rietveld refinement extracted via gsas2, for microstructural analysis using ETEX software?

09 August 2024 7,718 0 View

How are iso-frequency contours plotted?

Let's say we have a standard, regular hexagonal honeycomb with a 3-arm primitive unit cell (something like the figure attached; the figure is only representative and not drawn to scale). The...

07 August 2024 1,937 1 View

How to prepare the nanoparticle treated fungal sample for Environmental SEM analysis?

A fungal strain was treated with nanoparticles. We want to do an environmental SEM analysis. So could anyone share your views on preparing the sample? Thank you.

07 August 2024 5,307 1 View

How to normalize and take the significance of the MTT OD values with 3 replicates for the same cell-line?

Hi, I have a question about normalizing the MTT OD values for doing the statistical analysis. So, if we have 3 different plates and we call them 3 different replicates, so, first we would...

07 August 2024 8,106 4 View

Why does my protein refolded to beta sheet during thermal denaturation analysis?

Hi! So i attempted to understand a novel protein behavior towards heat application by analyzing its secondary structure change. I subjected the protein to a thermal denaturation analysis using...

06 August 2024 1,989 3 View

Ai-Ying Wang

Maybe you have to talk about what your research question is in detail.

From the NJ dendrogram, I can only see two subgroups. But some of them are in low bootstrap value.

Athanasia Pavlopoulou

I would suggest to use, along with the NJ method, the SplitsTree method for tree reconstruction:

https://en.wikipedia.org/wiki/SplitsTree

This method is recommended for identifying any conflicting phylogenetic signals.