What is the optical density normally kept for test cultures used in agar well diffusion assay?

More Surajvanshikumar Suvarna's questions See All

How to apply Hiddem Markov model for DNA sequence ?

Good morning to all if i have following random DNA sequence then how to find intron and exon manually for Hidden Markov model...

03 June 2023 5,447 2 View

Regarding intron and Exon in DNA sequence?

For example i have hypothetical small DNA sequence with 30 bp i.e AGCTTGGCAATCGGTAGGCTAGATCGTACCT. Now i want to count how many transitions between Intron, Exon and Splice site manually. can...

19 April 2023 3,766 5 View

HIdden Markov model?

How to train HMM in R. i tried with depmixs4 but show error for my data.

08 April 2023 3,023 2 View

Example for LHMM?

Can anyone give me the numerical example for Layered Hidden Markov Model Layer should be grater than or equal to 2. Thankyou

19 March 2023 7,350 3 View

Best software for drawing Markov plot?

What is best Software or website to draw Transition diagram or Markov plot freely Thankyou

13 March 2023 3,397 1 View

Regarding Markov chain when data is binary?

Hello Everyone, For example i have 3 states Markov model i.e Healthy, Sick and Death. i collected data in the last year. data form is like yes or no for each. Simple example is Healthy state...

18 December 2022 6,063 4 View

Regarding Diabetes chromosomes ?

which chromosome affected diabetes(chromosome 6 ?) or any other also. and also suggest me where i can get chromosomes list wise diseases and gene Thankyou

03 December 2022 7,549 7 View

Regarding DNA sequence?

Good morning, How to predict next generation DNA sequence by Hidden Markov model. I read some material about but unable to get for example my random sequence is ATCGAAGTCCCGGATCGATGA from this...

02 November 2022 6,567 3 View

Regarding DNA sequence, how to know?

i want to know how to find intron and exon in DNA sequence let my sample be CTGTTGGTGCAATGCCACGGAGACATGGGTGACCTATGGAACATGTTCTCAAACTGGTGAACACCGACGA Thankyou

27 October 2022 140 2 View

How to convert Intensity (V/MicroAmps) in to Intensity(CPS/MicroAmps) unit in emission spectrum?

While recording emission spectrum the Y axis will show the unit Intensity(CPS/MicroAmps).I recorded spectrum in IR range where the unit showed as Intensity (V/MicroAmps).How to interconvert this?

15 August 2022 8,548 0 View

Is changing the medium during the experiment overestimate the results?

I am experimenting with cancer and non-cancer cells in a 12-well plate for 4 days with a seeding density 1*10^4/well, however, I noticed that the control group growth rate slows down on D3. Should...

07 August 2024 2,283 2 View

Is it possible to plot the atom-projected band structure using GPAW?

Hi, I'm currently working on a project where I need to plot the atom-projected band structure using GPAW. I've been able to calculate the band structure for my material, but I'm having trouble...

07 August 2024 269 3 View

Should I include H atom into C3N5 when i am doing DFT modelling?

Hi all, my experimental XPS results shown that my C3N5 sample consists of N-H bond, hence in this case I should incorporate the N-H bond into my DFT modelling. However, I do notice several papers...

07 August 2024 8,414 2 View

How to normalize and take the significance of the MTT OD values with 3 replicates for the same cell-line?

Hi, I have a question about normalizing the MTT OD values for doing the statistical analysis. So, if we have 3 different plates and we call them 3 different replicates, so, first we would...

07 August 2024 8,106 4 View

Why activated CAR-Jurkat cell could not kill targets?

Previously when I co-coluture anti-CD19(FMC63) CAR-Jurkat with Raji with E:T=5:1, Jurkat can eliminate Raji in 24h. However, when I test another CAR construct, although I can dectect totally CD69...

06 August 2024 641 2 View

Are there instances where molecules with larger molecular weights exhibit greater mobility than those with smaller molecular weights?

Hi, I know that low molecular weight (MW) molecules generally tend to have higher mobility, while high molecular weight molecules tend to have lower mobility. However, in my experimental...

06 August 2024 1,495 2 View

Weak DAPI staining after immunohistochemistry - how to improve?

After immunohistochemistry of previously fixed in PFA and EtOH and then frozen 20 μm sections of zebrafish brain, DAPI staining is very weak (right) compared to the same sections stained without...

05 August 2024 9,637 2 View

For an in-vitro drug release study, what molecular weight cut-off (MWCO) dialysis bag is required for a 117 kDa protein?

kindly reply me. Thanking you in advance.

05 August 2024 7,727 4 View

Why wait for a doctor's visit when you can become the guardian of your child's health today?

Join our exclusive WhatsApp group and access the latest research-based videos on children's health! Discover the hidden toxins and other risks that may harm your kids, and learn the best practices...

04 August 2024 1,264 0 View

Ready to take control of your child's health and well-being?

Join our exclusive WhatsApp group and gain access to the latest research-based videos on children's health! Uncover the hidden toxins and other risks that may threaten your kids, and equip...

04 August 2024 5,895 0 View