Hi,
I am trying to anneal oligos
5'attacgccTAATACGACTCACTATAGNNNNNNNNNNACTAGCAACCT3'
3'TGATCGTTGGAGTTTGTCTGTGGTACCGGACGTCCCCGC5'
Font in italics is the area of intersection.
I have tried to PCR the two primers but that doesnt work either. Does the common region of intersection need to be greater than 20mers?
Thanks
I'm a bit confused about your setup here. Are you just trying to make a very short piece of DNA?
These primer won't anneal - the 11 bases at the end of the first primer are complimentary to the first 11 of the second primer, but they both read 5' -> 3'. (i.e., they are complementary but not reverse. Imagine rotating the sequence 180 degrees. That also means that the rest of the second primer overlaps the first primer)
For the reverse try TTTGTCTGTGGTACCGGACGTCCCCGCAGGTTGCTAGT.
If you can, increase the length of the complimentary section, 11 bases is quite short. For normal PCR I aim for at least 15 bases, ending on a G or C if possible. As for the buffer to use it depends on the context of the primers - is there more DNA to expand beyond the primers? Changing buffer is usually because of G/C content of the template, with +/- DMSO if there are secondary structures you want to smooth out. It's all a bit empirical I'm afraid.
If you just want to create a stretch of dsDNA that's less than ~120bp, you can have these synthesised as oligos (Sigma does them this length). Design the first oligo and for the second oligo just put the full reverse compliment. Then mix them 1:1, boil them and let them cool slowly. They should anneal into dsDNA.
Hi,
I am sorry the reaction could be confusing. The other template is mentioned in the 3' to 5' end to show a region of 10 mer overlap. The reason I couldnt do a complementary strand is because I want the region to be random.
Thanks,
Anjali
I agree with Michael. I usually take two oligos (reverse complimentary to each other), boil them in a heating block for 3-5 minutes and allowed to cool slowly. They will be annealed into single dsDNA. You don't need PCR here. It will only work if your sequence is perfect. Your oligo sequences will anneal only at the overlap region but it is very small region so i doubt if this would work. I recommend at least 15-18 bp overlap region. Why do you want to create such fragment with overhangs on both sides?
I have randomers on one fragment which is why the issue. I do my usual oligos in the same fashion as suggested by both of you.Thanks :)
Dear Anjali, what is your final goal in this case? What to you need in the end? Do you want to elongate this overlapping region? Because your oligos will perfectly anneal after boiling and gradual cooling-down, yet they will melt subsequently if the temperature is too high for them. As for the standard PCR buffer, your 10-mer duplex will be 50%-melt after 32 degrees Celsius. So it is basically stable when it is in a cold solution only.
So if you need to amplify this whole 75-mer overhanged duplex, you will need to elongate it with a low-temperature polymerase and only then perform PCR.
Similar to Peter's suggestion, you could try a Gibson Assembly reaction. Actually, if you look at the manual for the NEB Gibson kit you'll find some tips on annealing.
- Badges
- Science topic