17 Questions 37 Answers 0 Followers
Questions related from Anjali Pai
If say pCru5‐IRES‐mCherry‐F2A‐Puro plasmid, the GAP promoter is used for transcription? In this case, what is the +1 nucleotide of the transcripts? I was wondering if this plasmid can be modified...
11 November 2018 7,512 5 View
Most promoters used in the synthesis of RNA using in-vitro synthesis kit use +1G in their transcript. Is there a way in which this nucleotide can be escaped. Using RNase H may decrease the quality...
11 November 2018 5,086 0 View
Dear coders and bioinfo enthusiasts, I wanted to elucidate the effect of nucleotide context on Cap proximal nucleotides in the 5' transcript leader. I wanted to look at existing TSS data from...
12 December 2017 4,661 0 View
I am trying to transfect RNA into cells. My transfection experiments seem successful as my luciferase readouts are to the tune of 100000 for 10 ul of cell lysate. When I obtain total RNA after...
01 January 2017 8,610 3 View
I am planning to make small RNA molecules and cap them. I want to check the ability of these m7G RNA's to eIF4E/eIF4F complex, whichever may be easier. Has anyone done anything like this before...
07 July 2015 9,736 2 View
Hi, I am making a DNA modification using DNA ligations, then making invitro produced RNA, capping it and transfecting the RNA into cells. Then I do a total RNA extraction followed by reverse...
05 May 2015 5,234 6 View
Hi, I annealed two primers at 95C for 10 min and cooled them to room temperature. They look like the figure attached below with a 20mer overlap. I want to fill in the duplexes but as I am using...
03 March 2015 8,346 7 View
Hi, I am trying to anneal oligos 5'attacgccTAATACGACTCACTATAGNNNNNNNNNNACTAGCAACCT3' 3'TGATCGTTGGAGTTTGTCTGTGGTACCGGACGTCCCCGC5' Font in italics is the area of intersection.I have tried to PCR...
02 February 2015 1,637 7 View
Hi, There is a way to make the actual enzyme but the post purification step may involve getting an enzyme that is not active as the fplc in the department is not the best. Does someone have more...
02 February 2015 978 5 View
Hi, I am using a Brendel assembly of UA6 detector and Fractionator. As we dint have an engineer assemble it for us, we tried our hands at it. I wanted to know if there is a set program for...
02 February 2015 216 3 View
I have a 38 mer RNA GGGACAACTGTGTTCACTAGCAACCTCAAACAGACACC that I am trying to cut using a chimera Deoxy(GAAC)--2'Omethyl RNA (ACAGUUGUCCCGCA) to give a smaller RNA. I mixed the rna and chimera...
01 January 2015 213 4 View
As the RNAse H may not be 100% efficient at clevage, I want to seperate the cleaved from the uncleaved. I cannot seperate them on a gel due to their miniscule size difference of 15nt against a 1.9...
10 October 2014 7,089 6 View
I am planning to use RNAse H to get rid of the GGG from the T7 promoter post in vitro transcription
09 September 2014 4,648 2 View
I am planning to use RNAse H to remove the GGG from the T7 promoter in the resulting RNA post IVT. Has anyone used RNAse H? Which product works best?
09 September 2014 6,004 4 View
I am trying to dephosphorylate RNA and ligate it after. My controls seem to work fine except for a long RNA which I suspect can't dephosphorylate probably due to secondary structures. I have tried...
08 August 2014 909 8 View
I have made two RNA's of sizes 1.9 kb and 1.915kb using in vitro transcription method. I am using a 5% PAGE Urea gel to resolve this. I denature my samples at 80 degrees for 90 sec and use a 3x...
07 July 2014 3,566 7 View
Hi, I am looking for a working protocol to dephosphorylate the 5'PPP into a 5'P using NEB Rpph (https://www.neb.com/products/m0356-rna-5-pyrophosphohydrolase-rpph). Do you denature RNA before...
07 July 2014 9,460 1 View