What is the best choice for a targeting peptide?

04 February 2025 0 6K Report

If you wanted to choose a targeting peptide for the targeted delivery of nanoparticles against cancer (it’s better to kill two birds with one stone by combining targeting and cytotoxic effects), which peptide would you choose?

Badges
Science topic

More Fateme Araste's questions See All

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

How to use CINPE4 elements in ABAQUS for infinite boundaries?

Hi All, I have used infinite elements in Abaqus to absorb waves at the sides and bottom boundaries of the soil domain. but the boundary reflected wave can not be completely absorbed on the...

06 June 2024 448 4 View

How merge output files of simulation with NAMD?

I have been running steered molecular simulation with NAMD, but in the middle of my simulation it has stopped and i have restarted from specific steps which had stopped. Finally i have two parts...

19 May 2024 1,483 2 View

What is the reason of pattern of lithography in center of wafer are thicker in comparison of edges of the wafer?

Hello When we pattern a mask in a wafer, after exposure we noticed that the length of our patterns in the center of our wafer is thicker in copmarison with edges of it. What is the reason and...

22 April 2024 6,796 4 View

Why exon number change by zooming out in Genome Browser?

Why does the number of exons of PTPRQ change by zooming out in Genome Browser site? the NM number is: NM_001145026.2

21 April 2024 8,336 1 View

No matches result in silico PCR at Genome Browser webpage!?

I want to check my designed primers by in silico PCR in Genome Browser. but always face with this message [ No matches to cagatgagtcagtgccgttag agtaggtgctgactggttcc in Human Feb. 2009...

06 April 2024 3,951 4 View

What is the role of surface tuxture in anti gravel coatings?

Anti gravel or stone chip resistant coatings are often defined as textured coatings. Does the tuxtured surface play a role in the coating performance, especially in anti gravel properties?

22 March 2024 7,758 0 View

Have you ever run a steered molecular dynamic simulation with NAMD?

Hi everyone. Is there anybody here who have run a steered molecular dynamic simulation with NAMD and knows about the parameters which i have to write in my configuration file?

05 March 2024 7,935 1 View

How can the bitter taste from calcium chloride treatment in a protein product be minimized while maintaining the desired texture?

Greetings esteemed colleagues, I am currently working on my master's thesis, focusing on a protein product that requires the use of calcium chloride treatment in one of its stages to form calcium...

24 February 2024 1,806 2 View

How could i minimize and equilibrate system with available output files of CHARMM-GUI for NAMD?

I have downloaded output files of CHARMM-GUI for NAMD which i had made membrane-protein complex with CHARMM-GUI and now i don't know what should i do with these files before running simulation...

13 February 2024 4,182 0 View

Is this a facetotecta nauplius?

This larva was captured using a plankton net in the Persian Gulf during the summer. I believe it may be a Facetotecta nauplius.

08 August 2024 3,746 4 View

May members post flyers about opportunities to present at a conference? If so, where to post?

May members post flyers about opportunities to present at a conferehttps://veraeducation.com/nce? If so, where to post for the Virginia Educational Research Association? https://veraeducation.com/

08 August 2024 4,585 1 View

How to increase simulation box size?

We intend to study the interaction between peptides and polymer (like PP, PE and PS) through MD simulations using Martini force fields ( Martini 2 for PP and Martini 3 for PE, PS). We have...

08 August 2024 4,842 0 View

Hello all, Looking for international reviewer to review Ph.D thesis in wireless sensor network.Can anybody help?

My name is Apurva Saoji. I am a Ph.D scholar in Computer engineering in India. I am looking for international expert in reviewing my PhD thesis, "Competitive Optimization Techniques to Minimize...

07 August 2024 4,600 2 View

Unusual intensity drop in some sections of chromatograms in DDA?

Hi, we have measured tryptic peptides using both DDA and DIA method on QExactive. In DDA replicates i saw unusual intensity drops occurring at the same sections of chromatograms in DDA replicates...

07 August 2024 3,218 4 View

Are there any instruments for studying time similar to the way it is in space?

There are a huge number of methods for studying objects in space, according to the senses (and not only). Mechanical, thermal, optical, acoustic, electrical, magnetic, based on particle beams,...

06 August 2024 7,102 0 View

Research Methodology - Impact of Corporate Reputation on Stakeholders Behaviors?

Please can anyone support with the survey questions based on RQ measures and propose how to do it in FMCG industry and include as well the role of brand equity Thanks

06 August 2024 949 0 View

Anyone having idea about VN primer for miRNA primer design ?

How to design VN primer to attach with universal reverse primer

05 August 2024 2,116 3 View

Why my colony PCR results of my recombinant bacterial not showing any results?

I am performing ligation of the plasmid and a target gene. The steps I have taken are: 1. Double digestion of the plasmid and target gene 2. Ligation of the plasmid with the target gene 3....

05 August 2024 2,570 3 View

How to report results of Generalised Linear Mixed Models in a journal article?

Hi everyone, If you have written or come across any papers where Generalised Linear Mixed Models are used to examine intervention (e.g., in mental health) efficacy, could you please share the...

04 August 2024 4,130 4 View