Hello,
I am referring the book chapter "Application of CRISPR/Cas9 to Autophagy Research" https://doi.org/10.1016/bs.mie.2016.09.076 to generate a Huh7, ATG5 KO cell line by NHEJ. I am getting the puromycin resistant cells, but I don't see KO of ATG5 in my cell. Now I am planning to use HDR for my KO experiment so that I can insert a GFP visual marker. But I am getting trouble to locate the homologous sequence in the genomic DNA.
1. I am using the book chapter recommended sgRNA sequence "AACTTGTTTCACGCTATATCAGG". Just to double sure about the sgRNA sequence I used Chop-Chop online.
sgRNA prediction tool.
2. I could also locate the sgRNA sequence in the reference sequence (mRNA) NM_001286106, but the problem is that I am unable to locate the same sequence in the genomic DNA (GenBank: AL022067.1) sequence to design my donor DNA sequence for HDR.
Any suggestions...
Figured out!! My gene is encoded in the reverse strand.
I also found Ensembl database helpful for analyzing the gene for CRISPR/Cas9 work.
- Badges
- Science topic
- Similar topics
- Biological Science
- Microbiology
- Virology
- Virus