I am trying to replicate using a set of primers mentioned in a paper Article Quantification of Fusarium solani f. sp. glycines isolates i...
The thermal cycling conditions mentioned are 95 degree celsius for 120 seconds, then 45 cycles of 95 degree celsisu for 120 seconds, 60 degree for 30 seconds.
What does it mean? I tried carrying out PCR as follows,
94 degree celsius for 1 minute, 95 degree celsisu at 2 minutes, 60 degree celsius for 2 minutes, and 72 degree celsisu for 1 minute and 72 degree celsisu for 5 mintues and 4 degree celsius for infinite. The number of cylces are 45.
But, I did not get any band.
I tried using 100 micromolar and 10 micro molar concentration of the primers too.
Did I do something wrong?
Do you guys have any suggestions?
Bhawana,
First of all, I want to mention that not always a published protocol can be exactly replicated. It depends on many factors including the reagents you are using, primer purification method, the thermal profile of the cycler etc, which vary from lab to lab. So, it always takes certain amount of standardization.
Second, the method (pubished in the paper) you are using is a standard real time PCR thermal profile, where the annealing and extension steps are merged and allowed to happen at 60C. So if you are doing a conventional PCR, then do the annealing and extension separately.
Third, the thermal profile published in the paper seems to have a problem. Denaturation at 95C should be done for 30 s, followed by annealing+extension at 60C for 120 s.
You check the Tm of your primer pair using the following tool, which gives nearly accurate results. You have to input the sequence and PCR conditions, then analyze.
https://eu.idtdna.com/calc/analyzer
Evaluating your primers, I suggest you to try the following PCR program:
95 for 3 mins
40-45 cycles of
95 for 30s
50-55 for 30s (try doing a gradient PCR for optimization)
72 for 60s
Final extension at 72 for 15 mins
hold at 4C.
Use final conc of 0.25-0.5 uM of each primer, 200 uM of each dNTP, 100 ng of template DNA and 1.25U of Taq Pol in a 50 uL reaction.
best of luck.
SD
Jaroslaw , I am using Green master mix.
I tried Gradient PCR.
I have a question to Sibnarayan Datta.
Which primer did you analyse for getting those outputs?
I am having problem with the soybean primers with sequence F CCTGATGGGCAGGTTATCACTAT
R GGTACAAGACCCCCGGACAT
What analysis did you do?
Hi Bhawana,
I checked the primers (FSGq1/FSGq2) that were in the published paper using the Oligoanalyzer Tool, which I referred to in my first reply.
For your present primers for soyabean, keeping the PCR final conditions at 0.25 uM each primer, 50 mM Na+, 1.5mM MgCl2 and 0.2 uM each dNTP, the Tm calculated for forward primer is 63C and for reverse primer it is 64.8C.
So I would expect the primers to work at 60C annealing temperature. If they are not, then try performing a gradient PCR with 55-65C range of Ta.
Please go through the attached oligo analysis report.
I did a quick BLASTn search and to me, the primers do not look very good for universal amplification of soyabean actin gene. The forward one is to some extent better, but the reverse primer has a mismatch at the 3' end, which is very crucial for polymerization initiation. So I would suggest you to design your own primers, using an alignment of maximum sequences possible to get best primer pair.
Best wishes,
SD
Sibnarayan Datta, I am trying for the Soybean actin genes actually. Thanks though. Any idea on that.
Hi Bhawana,
Since I never worked on soyabean, I am not the right person to comment on soyabean actin specific primers. However, you may go through the following paper for the same. primer sequences are given as supplementary information along with the online paper.
https://www.nature.com/articles/s41598-017-07832-2#Sec21
Best of luck,
SD
https://doi.org/10.1186/1471-2199-10-93. This paper might interesting for you
- Badges
- Science method