CCCGGTATCCAATAGAATCGAA SAP10F
TCAGTGAA TGTGACGAA TTTGAAGA SAP10R
Thank you very much.
Hi Nehal,
The optimal annealing temperature can be calculated with the following formula:
Ta Opt = 0.3 x(Tm of primer) + 0.7 x(Tm of product) - 25; where Tm of primer is the melting temperature of the less stable primer, and Tm of product is the melting temperature of the PCR product. The simplest formula to calculate Tm values is:
Tm = 4°C x (number of G’s and C’s in the primer) + 2°C x (number of A’s and T’s in the primer)
There are more sofisticated methods to calculate Tm such as the salt adjusted and there is plenty more information online.
There are however numerous apps and websites where you could just copy/paste your sequence and get your annealing temperatures although I would recomend you calculating it manually until you understand the concept.
Hope this helps,
Ezequiel
- Badges
- Science method