Naseer Ullah

3 Questions 5 Answers 0 Followers

Questions related from Naseer Ullah

PCR will be give result if three nucleotides are different in primer from original sequence?

I ordered a primer when I received it where one nucleotide is different in the forward primer. the original sequence is: CTCTTTGGGCTCAGAGTGAGTCTGG the sequence which I get:...

24 October 2024 9,406 7 View

Is there any protozoan or bacterial pathogen can effect the human fertility?

There are many causative agents of of human infertility in which the main causes is either genetical or hormonal. The protozoans and bacteria may cause different type of infections. Is there any...

09 January 2015 1,634 4 View

Is consanguineous marriage one of the causative agent of human infertility?

Some of our researchers believe that consanguinity is one of the causative agent of human infertility. Is it possible or not? If the consanguinity is the causative agent, then what is the reason...

18 December 2014 6,469 14 View