PCR mutagenesis: no transformed colonies failure?

02 February 2016 7 5K Report

I've been trying to introduce a nucleotide substitution into a minigene. My protocol includes PCR amplification (with minigene as template) using KAPA HiFI PCR kit with 4 different forward primers(to introduce nucleotide changes at different position) and 1 common primer. Amplification is followed by DpnI digestion to get rid of parental bacterial template. So far i could not get any colonies after transformation despite having tried annealing temperatures of 58 , 54 degrees celcius. I am certain it is an annealing temperature 'problem' as I performed gel electrophoresis on the PCR product but could not get any products.

It is noteworthy that i the forward and reverse primer that i use has an overlapping region. I am not sure myself as to the strategy here as I am just an undergrad. but i hope the below information helps..

Minigene template

ctgtctaatcatgagtattggaataggatctgggggcagtgagggggtggcagccacgtgtggcagagaaaagcacacaaggaaagagcacccaggactgtcatatggaagaaagacaggactgcaactcacccttcacaaaatgaggaccagacacagctgatggtatgagttgatgcaggtgtgtggagcctcaacatcctgctcccctcctactacacatggttaaggcctgttgctctgtctccagGTTCACACTCTCTGCACTACCTCTTCATGGGTGCCTCAGAGCAGGACCTTGGTCTTTCCTTGTTTGAAGCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCATGAGAGTCGCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATGTGGCTGCAGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGGACTATTATGGAAAATCACAACCACAGCAAGGGTATGTGGAGAGGGGGCCTCACCTTCCTGAGGTTGTCAGAGCTTTTCATCTTTTCATGCATCTTGAAGGAAACAGCTGGAAGTCTGAGGTCTTGTGGGAGCAGGGAAGAGGGAAGGAATTTGCTTCCTGAGATCATTTGGTCCTTGGGGATGGTGGAAATAGGGACCTATTCCTTTGGTTGCAGTTAACAAGGCTGGGGATTTTTCCAGAGTCCCACACCCTGCAGGTCATCCTGGGCTGTGAAATGCAAGAAGACAACAGTACCGAGGGCTACTGGAAGTACGGGTATGATGGGCAGGACCACCTTGAATTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGGCCCACCAAGCTGGAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTGGAGAGGGACTGCCCTGCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGACCAACAAGgtatggtggaaacacacttctgcccctatactctagtggcagagtggaggaggttgcagggcacggaatccctggttggagtttcagaggtggctgaggctgtgtgcctctccaaattctgggaagggactttctcaatcctagagtctctaccttataattgagatgtatgagacagccacaagtcatgggtttaatttcttttctccatgcatatggctcaaagggaagtgtctatggcccttgcttt

forward primers (online tool indicating melting temp in bracket)

HFE exon2 muta -2C F (70.9 ºC)

GGAAAATCACAACCACAGCAACGGTATGTGGAGAGGGGGCCTCACC

HFE exon2 muta 4C F (71.7 ºC)

GGAAAATCACAACCACAGCAAGGGTACGTGGAGAGGGGGCCTCACC

HFE exon2 muta 5C F (70.7 ºC)

GGAAAATCACAACCACAGCAAGGGTATCTGGAGAGGGGGCCTCACC

HFE exon2 muta 4C5C F (71.7 ºC)

GGAAAATCACAACCACAGCAAGGGTACCTGGAGAGGGGGCCTCACC

reverse primer

HFE new muta cmnR (65.2 ºC)

TGCTGTGGTTGTGATTTTCCATAATAGTCCAGAAGTCAACAGTGAACATG

anyways i am trying annealing temperature at 50 degrees celcius, and another set at 48 degrees celcius

i will keep you guys updated but is there anything wrong or advise that you can give as at this point?

*panicky

Syed A Ali

Judging from your forward and reverse primer sequences, it is not site directed mutagenesis; is that right? Besides, the 4 forward and 1 reverse primers are not in the same tube rather 4 individual reactions?

Jeff Zaki

Yes it is 4 individual reactions with each forward primer differing in 1 nucleotide as compared to the minigene template and thus 1 nucleotide change.

Jeff Zaki

Failure for annealing temperatures at 50 and 48 degrees celcius as well. Oh well. But there is a lot of colonies for products not treated with dpn1 which suggest template is present and transformation procedure worked well.

MusT be my primer design. Any Thoughts?

Syed A Ali

This is not whole plasmid PCR-based site directed mutagenesis (that uses complimentary primers with desired mutation in the middle) then what it is? Please explain the principal behind your technique. I am kind of failed to get exactly how you are planning to do this mutagenesis.

Jeff Zaki

Hi syed ali. Im sorry about my lack of knowledge but yes im using forward primers with 1 nucleotide change in the middle using a whole plasmid(circular minigene) and thus it is site directed mutagenesis(it fits your description).

Also the template i showed is just a small portion of the entire plasmid but it is shown so as to allow you guys the spot the site of mutagenesis.

forward primer

My strategy of forward and reverse primer is such that as drawn above it partially overlaps. Do let me know if i should furnish further details. Im totally in need of guidance

Jeff Zaki

As at this point of time i can only think about maybe secondary structures forming in my primers. Hmm.. I can either increase annealing temperature above 58 or redesign primers. If its redesign how can i improve this design

Jeff Zaki

Good point

Why the need to use different minimal media to grow bacteria?

Cell Biology field: Relative easeness in publishing papers?

What other phohpshorylated components can i look for downstream of activated FAK and P38 MAPK?

Are they any phosphorylation-specific proteins for hypoxia effect on cells?

Hypoxia induced: No HIF-1a overexpression seen at transcript level but seen a lot of hypoxia and HIF-1A -induced genes?

Proliferation assay : manual cell counting?

QPCR: analyses involving in-between plates?

Time course gene expression analyses: RNA seq over mass spec?

Why is RNA expression analysis better than protein for looking time course gene expression analysis?

RNA expression vs protein expression patterns upon stimulation- are RNAs more dynamic?

MD MOE RMSD

MD MOE RMSD

fatal error

fatal error

fatal error

fatal error

Protein-aptamer gel electrophoresis help, please??

What kind of fluid could I use for a pitfall trap that also does not invalidate molecular testing?

Can linear DNA be used as template for site-directed mutagenesis?

In PRIMER, is it possible to downweight certain taxa in multivariate community datasets to reflect uncertainty around identification??