In short, I am trying to get a clone of 1664 bp insert in a mammalian expression vector (Size of vector is 6250 bp) by using NEBuilder HiFi DNA assembly Cloning kit with commercial Comp cells provided with the Kit. I tried this strategy three times and all got failed while I got huge number of colonies in positive control provided with the kit. Firstly, I am explaining a bit about the primer I designed for this strategy. I designed the primer based on the region where I want to put insert in vector. In vector primer sequences, I kept overlap for insert while In insert primer sequences I kept overlap for vector. I am providing primer sequences here
Vector Forward: CACCACCCTTCTCTTCCTGAATGGCCCCAGGCATCTGCC
Vector Reverse: CCATCCCCACCTGCCAAGATCTTGTCATCGTCGTCCTTG
Insert Forward: CAAGGACGACGATGACAAGATCTTGGCAGGTGGGGATGG
Insert Reverse: GGCAGATGCCTGGGGCCATTCAGGAAGAGAAGGGTGGTG
After this, I followed this strategy for cloning and transformation according the manual provided for HiFi Assembly kit. I am getting huge numbers of colonies in positive control while I am not getting a single colony of my sample plate. I also run ligated product on the gel and it seems that ligation is happened. I am attaching its gel image as well as transformation result of positive control.
Could, someone help me out here that why I am not getting any colony of my sample. Thanks in Advance!
If that plate is representative of your positive control, I wouldn't say it's "lots". But since you do get colonies that means the protocol and reagents all work.
Plate out more of of your cells for your gene of interest. Try a larger than recommended volume and/or make more plates.
Good luck!
After exhausting the common issues and fixes, consider the following possibilities:
1) DNA Rearrangement Issue; using special transformation host to minimize such recombination will help. In my hand, New England Biolab's
NEB® Stable Competent E. coli (High Efficiency), Catalog # C3040I or C3040H work well. In addition, incubation temperatures may be dropped down to 30C or less, during transformation and colonies expansions.
2) Toxic sequences
Need to use special "inducible vector system" while maintaining 'expression/translation silenced' (varies with the vector system) all through cloning and initial recombinant screening.
Good Luck!!
What is the directionality of your primer sequences? Because when they are all 5' to 3' then the primers seem to be flawed (I checked them)...
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Molecular Methods
- Cloning