Hi,
I am trying to clone miR96 precursor into the pcmv-miR expression vector.
These are my primers;
GCGATCGC: SgfI
ACGCGT: MluI
Bold sequences are overhanging sequences.
F:5’TATGCGATCGCTGGCCGATTTTGGCACTAGCACATTTTTGCTTGTGTCTCTCCGCTC -3’
R:5’TATACGCGTTTTCCCATATTGGCACTGCACATGATTGCTCAGAGCGGAGAGACACAAGC-3’
I incubate them at 94 degree 1 min, than aneal them at 50 (Their tm is 55) 15 sec, than I extend them at 72 degree 5 min.
I also tired to anneal at 37 degree.
I use 1 uL of 100uM stock to extend.
I perform agarose gel electropharesis %4 and check the extention rate by using both 50bp marker and loading non-extented oligos. I clearly see that extention is complated and my oligos are created pre-miRNA sequences.
I cut my vector and pre-miRNA product with mluI HF and sgfI restriction enzymes over nigh.
I perform general ligation with 10 ng digested vector at 20 ul total volume with 1:3, 1:5, 1:10, 1:25, :1:50, 1:100 and 1:200 molar ratios.
Unfortunately I get no colonies.
All the enzymes and transformation protocol works fine. BecauseI am using them in an other work and they works.
Would you please share your opinions for my experiments? Do you suggest me to try to clone miRNA by producing via PCR that contains 200bp flanking sequences from genomic DNA that is finally ~550 bp? Can it be easy to clone a higher fragment instead of 120 bp?
Dear schaefer,
Beyond the restriction sites I have added 3 nucleotides(Tat) to my oligos which neb says mluI can digest %100 acitivity.
The more, I perform gel prufication after overnigh restriction digest with guanidium supported collum based technique so I dont realy think that I need to inactivate enzymes.
When I digest my pcr product (in an other experiment) with these restriction enzymes agan containing extra, 3 bases I perform ligation quite well. So probably digestion ist a big problem. But I Wonder that do I try yo digest too much annealed oligos? I extend 100uM oligos than cut them. Can it be high?
- Badges
- Science method