Why is SolidWorks giving high thermal stress in an unconstrained part?

I'm running a thermal simulation with a temperature change from 293K to 88K. It's all 6061 aluminum. The temperature load is applied to all exposed faces. This sim is of a single piece with a...

11 October 2020 3,125 3 View

Does FuDR dissolve/dilute into NGM plates when administered to plates?

I am currently trying to use FuDR to run a lifespan experiment using C. elegans. I have a stock solution of FuDR that has been dissolved in water and am trying the determine the concentration of...

27 August 2020 1,674 1 View

Ask for help about wannier90, hopping matrix elements are not complex conjugate?

Dear All, I calculate band structure and hopping matrix of monolayer Graphene by using wannier90-2.0.1. There are two atoms in one unit cell, the following is input information : INCAR :...

26 February 2020 4,885 1 View

How to calibrate a T/C CO2 sensor in an air-jacketed CO2 incubator without an independent CO2 sensor?

I have an air-jacketed CO2 incubator and I need to calibrate its thermal conductivity CO2 sensor. However, I do not have a CO2 sensor that is independent of the incubator to measure the CO2...

31 January 2020 8,758 1 View

What is a good procedure to identify if the CO2 incubator is the source of contamination in my cell cultures?

I have read some vague descriptions about how to screen the CO2 incubator as the source of contamination. I saw recommendations to leave a plate of cell culture media in the incubator and view it...

12 January 2020 8,639 2 View

Have problems in insert sgRNA into lenticrispr v2 vector?

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...

28 December 2018 4,592 3 View

What is a good intro to flow through porous media?

I would like to find a way to build a model of the system I'm starting to research. Or really find any small amount of progress. Here's a snapshot of what's happening: Air is flowing (from atm.)...

16 October 2018 3,308 4 View

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

28 March 2018 6,378 2 View

Why is Capacitive Deionization at constant current preferable than at constant voltage?

Based on a journal that I read, CDI at constant voltage leads to having a shorter time in a given cycle when the system has reached its lowest effluent concentration. My question is, what's bad...

29 March 2017 1,718 1 View

Can I run a multiple regression with 150 cases altogether with hormones as independent variables to predict birth weight?

12 October 2016 6,081 4 View

What is your perception on using visual analysis or quantitative approaches to evaluate data from single-case research designs (n of 1 trials)?

Results of single-case research designs (i.e., n-of-1 trials) are often evaluated by visually inspecting the time-series graph and computing quantitative indices. A question our research team is...

03 March 2021 687 1 View

Heat exchanger with liquid Nitrogen as coolant?

I want to cool Natural Gas from 195 Kelvin to 138 Klevin in a heat exchanger by using liquid nitrogen as the coolant medium. When entering the heat exchanger, the liquid nitrogen will have a...

01 March 2021 6,450 5 View

How can I represent SDS-PAGE results for machine learning analysis?

I am trying to classify and analyze the results of an SDS-PAGE based array for bacterial detection using machine learning, but I have trouble finding the best way to represent the results with...

27 February 2021 9,176 3 View

How relevant is Mini slump cone?

for all the rheology researchers, my question is, how relevant is a mini slump cone (smaller than a standard 50 cent rheometer). currently based on testing, the thickness of slumped material is...

26 February 2021 3,668 1 View

How to approach CFD simulation results of a flow past a cylinder?

Hi all, I'm doing a transient simulation of flow past a rectangular cylinder close to the free surface. As far as I'm concerned, the common practice is to discard the initial stages of the...

25 February 2021 1,348 3 View

Why my agarose gel staining sometimes looks not homogenic but like gradient (see the figure)?

I am worried about this overexposure of the upper part of the gel in the picture. Is it possible that this is the result of too much concentration of ethidium bromide? Why is there such a big...

25 February 2021 8,140 3 View

EMSA troubleshooting. Protein-DNA complex not migrating, cold probe lane with multiple bands. Can anyone help?

I'm running an EMSA to show the DNA binding activity of recombinant proteins versus the Wild type. Previous assays run by my research group using a different test system show the protein-DNA...

24 February 2021 8,325 1 View

Problem with ligating 2.8 kb insert into 8.5 kb plasmid?

I am trying to clone 2 copies of the same mammalian gene into the pSF-CMV-Ub-Puro Ascl (contains HindIII, KpnI and NheI cut sites) plasmid. This is what the final product is supposed to look like...

24 February 2021 6,310 3 View

How to manage western blot for proteomics data validation?

Hi Everyone, I am a bigginer in western blotting and I am trying to use it for validation of my proteomics data. I have: two regulated proteins with molecular mass of 40 and 73 kDa one control...

23 February 2021 6,671 4 View

Alginate and silk fibroin hydrogels toxic to cells?

Hello, I asm currently working with alginate and silk fibroin hydrogels. I prepared a blend of alginate and aqueous silk fibroin (straight from dialysis) and resorted to ionic crosslinking to...

23 February 2021 8,249 2 View