I design primer for foxo3 mRNA (exon junction ) but when i check it for specifity it bind to the genomic sequence with same prduct length .
F: GGCAAAGCAGACCCTCAAAC
R: AACGGTATCACTGTCCACTTG
Hi Saeid,
If you go to http://genome.ucsc.edu/
Tool --> in silico PCR
And enter your primers, you will see that they actually anneal to the FOXO3B pseudogene as Jack supposed.
There is indeed a problem with qRT-primers binding to gDNA. The reason is that, in case you have DNA contamination of your RNA you won't be able to differentiate the RNA signal from gDNA. That is also the reason why you should also perform a no-RT control of your samples (trying to amplify your RNA without performing the reverse transcriptase step).
For more information about good practice with quantitaive PCR I invite you to read the MiQe guidelines which is an exceptional piece of work to start with (in attachment).
Best,
Article The MIQE Guidelines: minimum Information for Publication of ...
Hi,
You shouldn't have problems with that if you treat your samples with DNAse properly before the cDNA synthesis. There are many methods of verifying if the DNAse treatment works. One can check that simply by running an agarose gel,the genomic DNA band should disappear, leaving the intact RNA bands. Having another set of primeirs that would yield different products sizes from gDNA and cDNA and using it to test with normal PCR if there's is amplification of products of the size expected from gDNA would also work.
I hope that helps.
Cheers.
- Badges
- Science method