35 Questions 46 Answers 0 Followers
Questions related from Saeid Afshar
Recently we decide to evaluate the miRNA expression levels in saliva sample as diagnostic biomarker of cancer . We used TRIzol extraction methods but the CT of real-time PCR for U6 gene was...
09 September 2019 1,614 3 View
I use salting out DNA extraction methods . But recently after adding the ethanol we couldn't saw the DNA skein and DNA pellet . Finally the results of nano drop indicated that extracted DNA have...
09 September 2019 2,139 1 View
Recently we evaluate the serum IL-6 level in patients after radiotherapy . Unfortunately 4 of 7 samples are negative. we used the thermo fisher ELISA kit for this aim and 100 microliter of...
08 August 2019 2,866 5 View
I want to evaluate the ionizing radiation effects on miRNA expression level in mice. Some paper used PBMCs and others used whole blood ( WBC ) for RNA extraction . is there difference between...
05 May 2019 8,190 5 View
unfortunately during this month i couldn't access to the miranda microRNA target prediction tool web page . http://www.microrna.org/ is the web page address was changed ?
06 June 2018 9,514 0 View
I want to design primer for the lncRNA entitled nonhsat062994 but i can't find it at NCBI. how can i access to the sequence of this RNA?
05 May 2018 8,841 4 View
My friend sent me the agarose gel results. As seen in attached figure lower range of gel was dark and , i cant see any band in this region . how can i solve this problem?
12 December 2017 5,086 0 View
Recently two study indicated that mineral oil can be used for Dna extraction. Is there anyone who has the experience about this method?
11 November 2017 4,413 5 View
Recently we want to target a gene with siRNA , but i have a critical question how can i make sure that downstream pathway of this genes will be affected . on the other hand ho can i predict...
11 November 2017 2,101 3 View
I run the sds page but after transfer to membran and staining I saw that lower band are biger than higher band. How can i solve it?
09 September 2017 8,027 3 View
Recently ,we decide to extract cancer stem cell from primmery cancer cells. for this aim can we use the non-treated flask. on the other hand what is the difference of non-treated flask with...
08 August 2017 1,590 4 View
Recently i extract human stem cells from dental pulp. How can i confirm that these cells are stem cells and aren't fibroblast. I will perform flow cytometry for surface CD markers relatedto SCs....
06 June 2017 504 8 View
What is the mechanism of emission of labled sirna by fam. I have the question about emition ability of unlocalaized dye.
06 June 2017 4,702 2 View
I need the precise sequence of 43 bp double strand DNA. how can I do it precisely?
02 February 2017 1,726 1 View
I order the polyfect transfection reagent (Cat No./ID: 301105) . can use it for transfection of mimic mirna?
01 January 2017 2,993 4 View
last month we inject colorectal cancerous cell line subcutaneously to inbred balb/c mice . after two weeks we see the neoplasm ( 5 mm diameter ). based on the stained sample how can I confirm the...
01 January 2017 9,172 5 View
I want to order primer sets of RT-qPCR for miRNA detection based on the P K Busk et al paper ( without probe ) . Is the DNA Reverse Phase Column purification method is proper for this aim ?
12 December 2016 7,746 2 View
Is there any correlation between Ka and Ksv or these constants are different ?
12 December 2016 10,167 0 View
I designed the primer sets for miR-625 , but i have the problem with C-DNA synthesis for real-time PCR. i need the protocol of C-DNA synthesis . Is there anyone to help me about the reagents ,time...
11 November 2016 1,262 8 View
I order real-time PCR , cDNA kit and 8 primers from exiqon. but under the exiqon protocol, I couldn't see any results for one primer ( miR-625) The company says that the expression level of this...
10 October 2016 314 4 View
I can't find the flomax software for download . Is there any one tho help me for the link of software download? thank you
09 September 2016 666 0 View
I want to analyse cell cycle with flow cytometry "partec " applying PI. i used abcam protocol for staining with PI and fixation with 66% ethanol. SSC vs FSC plot is scattered very broad . how...
09 September 2016 5,004 4 View
I have survival fraction data of to cell line in different radiation dose.how can I calculate alpha and beta and how can I fit graph to this data with graphpad prism 6 software .on the other hand...
06 June 2016 8,079 4 View
I want to analyse difference between to dependent variable based on the time . How can i analyse this difference with spss?
06 June 2016 1,752 4 View
In order to analyse gene expression , we need gene expression information in excel or spss , but all outputs of GEO are in txt format . How can i convert this format ?
05 May 2016 8,673 2 View
I search ncbi for rora gene of mice and find mrna accesion numer (nm).I can't accesion number nm in rat but 3 xm accesion numbers were found. Can I designprimers for this gene in rat based on the...
04 April 2016 6,534 4 View
I design primer for foxo3 mRNA (exon junction ) but when i check it for specifity it bind to the genomic sequence with same prduct length . F: GGCAAAGCAGACCCTCAAAC R: AACGGTATCACTGTCCACTTG
04 April 2016 6,197 5 View
I radiate cancer cell line with 36 gy x ray radiation(11 fraction) The radiated cells are bigger than nonradiatet cells.
02 February 2016 4,175 3 View
I want to assay IGF2 gene expression with qRTPCR ( syber green ) . i design primer with alleleid 6 but after primer blast , all of them are non specific . for example they attache to "NR_003512.3...
01 January 2016 6,606 3 View
i want to radiate cell in t-flask(DMEM -FBS 10%) with 2 Gy dose. set up info: x= 10cm y= 12 cm ssd = 95 cm slab= 5 cm mu = 210 correction= 0.99 trp = 94 sp/sc= 1.007 are cells exposed to 2 Gy...
01 January 2016 8,020 2 View
I use FBS (gibco) as a serum sorce of cell culture medium ? Is it necessary to filter FBS before using in cell culture ?
01 January 2016 1,762 5 View
I visit the atcc web page but there isnt any information about the origin of hct116 cell line. Is there anyone who know more abote the origine of this cell line Please help me . Thank you
10 October 2015 2,889 5 View
i find article entitled" microRNA-451RegulatesMacrophageMigration Inhibitory Factor Production and Proliferation of Gastrointestinal Cancer Cells" . i send email to author (Dr eva bandres to gain...
03 March 2015 1,230 0 View
I need the mi-RNA profiling of radio-resistant gastric cancer. How can I obtain it?
02 February 2015 9,394 1 View
is there any database for miran profile of radioresistant gastric cancer cell ?
02 February 2015 5,551 3 View