for variciella zoster with primer sequence sense 5`GCGCGGTAGTAACAGAGAATTTC 3` and antisense of 5` ACGTGCATGGACCGGTTAAT 3`
Look at the negative control whether it contains the dimers or not. You can use
RNase H-dependent PCR to reduce the dimers if they are present.
To avoid primer-dimer and get your fragment amplified I suggest you the following:
- Adjust annealing temperature (but it appears that you already did this by using temperature gradient method);
- Use a PCR enhancer such as DMSO or BSA;
- Check your template. You might need to use more DNA or less;
- If you have any contaminants in your DNA that might inhibit your taq, diluting the DNA might also work well or using a kit to clean your DNA;
- If none of these solutions improve your amplification try to design another set of primers.
Did you include a positive control in the PCR ? A template that will definitely being amplified with the primer set that you designed?
You can also use a higher percentage agarose to get better separation of your PCR products. In general, you can separate products that are about 10% different in length on a standard agarose gel (e.g. can tell a 200 bp product from a 220 bp).
- Badges
- Science method