for variciella zoster with primer sequence sense 5`GCGCGGTAGTAACAGAGAATTTC 3` and antisense of 5` ACGTGCATGGACCGGTTAAT 3`
Look at the negative control whether it contains the dimers or not. You can use
RNase H-dependent PCR to reduce the dimers if they are present.
To avoid primer-dimer and get your fragment amplified I suggest you the following:
- Adjust annealing temperature (but it appears that you already did this by using temperature gradient method);
- Use a PCR enhancer such as DMSO or BSA;
- Check your template. You might need to use more DNA or less;
- If you have any contaminants in your DNA that might inhibit your taq, diluting the DNA might also work well or using a kit to clean your DNA;
- If none of these solutions improve your amplification try to design another set of primers.
Did you include a positive control in the PCR ? A template that will definitely being amplified with the primer set that you designed?
You can also use a higher percentage agarose to get better separation of your PCR products. In general, you can separate products that are about 10% different in length on a standard agarose gel (e.g. can tell a 200 bp product from a 220 bp).
We have been looking for the fueling effects of cytomegalovirus on HIVpositive patients. patients serum was tested for CMV by PCR and ELISA for IgM. We found discrepant results, that IgM positives...
12 October 2020 5,139 2 View
I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance
03 March 2021 3,568 1 View
I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...
03 March 2021 8,066 4 View
So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...
02 March 2021 1,146 2 View
I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...
01 March 2021 8,544 1 View
We are preparing some experiments based on irradiating cells under different conditions in order to evaluate the effects in terms of DNA damage, genetic expression, etc. As our project is...
01 March 2021 3,355 3 View
I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...
01 March 2021 360 7 View
I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...
28 February 2021 606 3 View
hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?
28 February 2021 1,254 3 View
Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.
28 February 2021 5,008 4 View
Hi I am a bit confused. They are asking me to find out the volume of DNA required in ul (a total of 30-100 ng for genomic DNA) from the DNA concentration in the nanodrop reading which was 404.8...
26 February 2021 5,029 2 View