Alene Geteneh

2 Questions 2 Answers 0 Followers

Questions related from Alene Geteneh

CMV- PCR versus IgM ELISA for studying co-infection ?

We have been looking for the fueling effects of cytomegalovirus on HIVpositive patients. patients serum was tested for CMV by PCR and ELISA for IgM. We found discrepant results, that IgM positives...

13 October 2020 5,203 2 View

is there any mechanism to differentiate primer dimmer from real amplicon in case of targeting small DNA fragment?

for variciella zoster with primer sequence sense 5`GCGCGGTAGTAACAGAGAATTTC 3` and antisense of 5` ACGTGCATGGACCGGTTAAT 3`

07 November 2019 8,040 3 View