2 Questions 2 Answers 0 Followers
Questions related from Alene Geteneh
We have been looking for the fueling effects of cytomegalovirus on HIVpositive patients. patients serum was tested for CMV by PCR and ELISA for IgM. We found discrepant results, that IgM positives...
13 October 2020 5,203 2 View
for variciella zoster with primer sequence sense 5`GCGCGGTAGTAACAGAGAATTTC 3` and antisense of 5` ACGTGCATGGACCGGTTAAT 3`
07 November 2019 8,040 3 View