I would prefer c-myc-NLS (PAAKRVKLD) over SV40 with C terminal tagging. In my own experience, c-myc NLS works better compared to other NLS sequences.

The SV40 large T antigen NLS can be used in both animals and plants:

DNA:

CCAAAAAAGAAGAGAAAGGTAGAAGACCCC

Protein:

PKKKRKVEDP

I have tried fuse this NLS to the N-terminus or in the middle of a protein. Both works in plants.

Thanks for your replies. Xiao, is there any particularity regarding whether the NLS should be attached to the C or the N terminus (for more efficient targeting)?

I have a GFP fused clone and I need to  transfect in animal cells.

There is nothing particular reason to tag an NLS at the N or C terminus. Both will work.

 I would prefer c-myc-NLS (PAAKRVKLD) over SV40 with C terminal tagging. In my own experience, c-myc NLS works better compared to other NLS sequences.

Tanveer, can you elaborate? I have a SV40 NLS, and it works well in HEK293T's but not at all in N2a's (mouse)... so i've been trying to research whether or not I need to clone in a better/more efficient NLS. Thanks in advance!

Dear Xiao, it is possible to change the original sequence PKKKRKV of the SV40 large T antigen NLS (simian virus 40) by PKKKRKAsp or PKKKRKTyr ?. Is described that original sequence appointed is functional in the filamentous fungi Penicillium chrysogenum. However, I need to modified the last amino acid of this sequence (Val by Asp or Try) because I need to introduce an restriction site (SpeI) to simplify my construction design...

Jessica Binder that's interesting. I just made a SV40 NLS fused mCherry and it worked really well in 293Ts but when I packaged it into AAV and injected in the mouse brain, it was in the nucleus but also in the dendrites.

• Raj M Rajebhosale I ended up using a cMyc NLS and it worked tenfold better in neurons

If you need the AAV, lentivirus and adenovirus protocols, you can see here: