Is there an easy way to unify sequences of COI-5P from the two database BOLB and GenBank (NCBI)?

More Emanuele Berrilli's questions See All

How can I check how different treatments maintain a certain pattern?

Hi there, I have a network where I have used different aggregation methods for its nodes. Now I want to see if these aggregation methods changed their ranking of importance and their importance...

28 January 2021 5,513 3 View

Why is Kendall's Tau always so high?

Hi there, I am trying to estimate the agreement of judges on the ranking of certain individuals - in particular, the agreement of all other judges with the first judge. I was thinking to use...

28 January 2021 3,121 4 View

Standard addition calibration without blank matrix available?

I have a problem of analytical chemistry. We are working on a spectroscopy technique (FTIR) for the quantification of a mineral phase in complex matrices. We intended to use chemometric techniques...

12 January 2021 7,739 1 View

How to obtain miRNA expression data in specific tissue with mean and coefficient of variation?

Hello everyone, I'm looking for miRNA expression level data (as measured by RNA-seq) in a specific tissue, but all papers I have consulted (and their relative supplemental material) do not report...

14 November 2020 9,762 2 View

Can CTAB stored in a refrigerator still be used to create extraction buffers?

Hello, Our lab is working on DNA extraction. We are creating new solutions for a new protocol. Unfortunately when our main CTAB (hexadecyltrimethylammonium bromide) stock was stored from last...

13 February 2020 8,652 1 View

Could anyone teach me how to use the "SR 7500 DC" SPR?

I should carry out a set of SPR experiments. In my lab I have the Reichert model "SR7500DC". I would need someone who could teach me how use this instrument and, above all, how to do the data...

29 December 2019 3,880 2 View

Power output of a micro Kaplan turbine that reduces linearly during 3 days from 16 kW to 13.65 kW with constant hydraulic and blades configurations?

There is a micro Kaplan hydro plant: Flow rate: 0.58 mc/s Head: 4.85 m RPM: 625 Max electrical power: 16.5 kW Generator+gearbox efficiency: 0.89 Maximum Turbine efficiency: 0.67 Draft tube:...

16 October 2018 7,111 3 View

Would you like to suggest me online public data where orthopaedic/musculoskeletal research is applicable?

I am trying to start a research basing on free published online dataset. My field of research is Orthopaedics. Thank you for any help!

08 August 2018 5,475 6 View

Does anyone know a good software to compile borehole log?

I need a software to write and compile borehole log for geological and geotechnical purposes. Thanks

19 February 2018 8,961 8 View

How to make an accurate Digital Elevation Model (DEM) using QGIS?

I have a file of points and lines with elevation data (z value) and I want to make an accurate Digital Elevation Model (DEM) using QGIS. The software allows me to make only a DEM with 12m cell...

18 February 2018 766 8 View

Can we classify HV and LV lines based on line length?

I have dataset which shows the length of power lines. I need to classify the lines based on the line length. Is there a rule to classify the High voltage (HV) and low voltage (LV) lines based on...

03 March 2021 4,116 4 View

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

What analysis to choose with a large neste dataset and clearly skewed or kurtotic distributions?

Hello! I have a dataset of n=3000 nested within 8 countries with approximately 200 or 400 responses in each country. I originally planned to perform multilevel modelling with 4 dependent variables...

02 March 2021 6,865 1 View

Do you know any MR image dataset?

I would like to research on MR images (0.5T and 3T). Can you please suggest some websites that I can download dataset including both 0.5T and 3T MR images? Thank you.

02 March 2021 7,735 3 View

Can NFL theorem be valid in infinite search space in ML?

NFL theorem is valid for algorithms training in fixed training set. However, the general characteristic of algorithms in expanded or open dataset has not been proved yet. Could you show your...

01 March 2021 1,189 3 View

Does anyone know HRM channel in a 2 plex QIAGEN Rotor- Gene Q qPCR can be used as a separate channel?

I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...

01 March 2021 8,544 1 View

Which cell line should we use to perform biological dosimetry experiments?

We are preparing some experiments based on irradiating cells under different conditions in order to evaluate the effects in terms of DNA damage, genetic expression, etc. As our project is...

01 March 2021 3,355 3 View

Does anyone have kinetic and kinematic dataset for gait classification?

I want to differentiate between normal and abnormal movement. For this reason, I am looking forward to this type of dataset.

01 March 2021 9,485 1 View

Where can I find public datasets with Covid-19 patient information?

Hi, I'm looking for public datasets that have CT, X-ray information, or medical records for patients with Covid-19. Does anyone have suggestions?

28 February 2021 4,760 3 View

I need dataset for recommandation system?

Hi every body I need to collect datasets from different source to work on recommendation system algorithms, could you advise me how collect data?

27 February 2021 7,063 7 View

Abhijeet Singh

Emanuele Berrilli

Better to use single and specific database
In case there is no such possibility, download Everything you want and then remove the duplicates. If you are command line familier, you can use biopython script named "Sequence cleaner" OR very easy to do it in Aliview.

Zhi-Teng Chen

I dont know how you interpreted from the above question and what are you suggesting. I dont Think it is what he want to do.

Nikolaus Szucsich

Dear Emanuele

Depends of what you downloaded

If you download a "combined" file from your search in BOLD then the GenBank Accession number is included and you can do it bioinformatically quite easy (given that you have likewise the same information from GenBank).

It is just that you will have to do some cleaning before maybe.

If you download just the sequencefiles as Fasta the Genbanknumbers are likewise included in the names line

e.g.

KJ124849 in

>GBDCU1042-14|Culiseta longiareolata|COI-5P|KJ124849

TACATTATATTTTATTTTTGGAGCTTGAGCTGGAATAGTAGGGACTTCATTAAGTCTTCTTATTCGAGCAGAATTAAGACACCCAGGAATATTTATTGGGAATGATCAAATTTATAATGTAATTGTAACTGCTCATGCATTTATTATAATTTTTTTCATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGAATATTACCTCCTTCATTAACACTACTACTTTCTAGAAGTATAGTTGAAAATGGATCAGGAACTGGATGAACAGTTTATCCCCCACTTTCTTCAGGAACAGCTCATGCTGGAGCTTCTGTTGATCTAACAATTTTTTCATTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACTACAGTAATTAATATACGATCAGCAGGAATTTCTCTAGATCGTATACCCTTATTTGTTTGATCAGTAGTGATTACTGCAGTTCTTTTACTTTTATCCTTACCAGTTTTAGCCGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTCTTTGACCCTATTGGAGGAGGAGACCCAATTCTTTATCAACATTTAT

All the best

Nikola

HI Abhijeet Singh, thanks a lot for the information. I resolved using vsearch program. I did a single fasta file from BOLD and GeneBank and than I dereplicate the sequences with vsearch command --derep_fulllenght. Do you know this progrma? I'll try also with Aliview.

Emanuele

Emanuele Berrilli Yes, vsearch is of course an option and good option to serve your purpose. If you have a large data set, better to use vsearch.

Abhijeet Singh thaks a lot for the help!

You can likewise use OpenRefine (http://openrefine.org/) for such purposes.