In an effort to reduce costs I ordered custom primers for PCR amplification prior to running on the Hiseq2000 and there were no clusters. I trusted our platform's technician blindly regarding what the sequences should be for attachment, since Illumina does not share this information. My forward primer started with this sequence: 5'-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTC... and my reverse primer started with this sequence: 5'-CAAGCAGAAGACGGCATACGAGATCGTGAT... (where the last 6 nucleotides were either CGTGAT, ACATCG, GCCTAA, TGGTCA, CACTGT, or ATTGGC for indexing purposes. Does anyone spot a problem?
Illumina do actually publish their primers (they don't make it easy to find though!)
Here is a link
http://supportres.illumina.com/documents/myillumina/6378de81-c0cc-47d0-9281-724878bb1c30/2012-09-18_illuminacustomersequenceletter.pdf
Are the sequences you have given complete? How did you construct the libraries? Did you anneal adapters together to make Y-shaped adapters for ligation to inserts?
If you are simply trying to amplify the libraries, use these two sequences:
IS5 (reamp.P5) AATGATACGGCGACCACCGA
IS6 (reamp.P7) CAAGCAGAAGACGGCATACGA
From Meyer & Kircher (2010): Cold Spring Harb Protoc; 2010; doi:10.1101/pdb.prot5448
Yours probably don't work well as the melting temp would be rather high??
Although this may not explain the lack of clusters... did you check the libraries on a BioAnalyzer/Tapestation/Qubit/etc?
The sequence you have used is TruSeq™ Small RNA PCR primer. Was it used for small RNA sequencing ? what was the adapter sequence used for library preparation ?
Those were not the complete primers. This was an oligo-capping experiment where 5'capped mRNAs were first capped with a primer in the Epicenter kit:
5' TCATACACATACGATTTAGGTGACACTATAGAGCGGCCGCCTGCAGGAAA 3'
and then 5' and 3' RACE PCR amplification of capped and polyadenylated mRNAs was performed.
The library was constructed using the forward primer (complete sequence):
5'AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTTTAGGTGACACTATAGAGCGGCCGCCTGCAGGAAA 3' and the reverse "random" primer: 5' CCTTGGCACCCGAGAATTCCANNNNNN 3'.
Then the final amplification was done using the same forward primer:
5' AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTTTAGGTGACACTATAGAGCGGCCGCCTGCAGGAAA 3'
and the reverse primer:
5'CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA 3' with the indexes described in the question.
At each stage there was nice amplification and a smear visible by agarose. I was even able to do gene specific PCRs using the oligo-capped primer and bands subjected to sanger sequencing showed transcriptional start sites at the oligo-capped primer.
The primer I sent along with the samples for sequencing was: 5'TTTAGGTGACACTATAGAGCGGCCGCCTGCAGGAAA3'
I don't follow the bit about Y-shapped adapters. Could you enlighten me?
Have you tried sigma Aldrich and invitrogen web sites for instructions about primer design.
Illumina do actually publish their primers (they don't make it easy to find though!)
Here is a link
http://supportres.illumina.com/documents/myillumina/6378de81-c0cc-47d0-9281-724878bb1c30/2012-09-18_illuminacustomersequenceletter.pdf
Try staining your FC with Sytox Orange (or some other dye) to see if you have clusters. Depending on which clustering reagents you used, you may be using an incorrect sequencing primer, and are not seeing the clusters because you didn't get a first base incorporation from the primers used. Before tossing the FC, I'd try staining first.
The "customer sequence letter" that illumina sent out a couple years ago, which is also the target of the link from @Gavin Wilkie, page 6, has adapter sequences similar to those that you report using but are much longer on the 3' end. Seems like this change would not prevent bridge amplification, since it should still hybridize to the oligos on the flow cell, but it might prevent the sequence reaction from working if you are using the standard primer in the sequencing kit which hybridizes to the part of the adapter that you left out. This might result in clusters forming but not being visible since they don't produce sequence signal, and the instrument identifies this as a lack of clustering.
You will not get much help from illumina on this, we had to have mutliple email exchanges and two phone calls before we finally figured out how to design oligos that would work on the MiSeq.
Hi Tim,
i found that your primer sequence has some issue...after "AATGATACGGCGACCACCGAGATCT" this sequence. Please check it again.
- Badges
- Science method