Hi,
I have been recently having issues with mycoplasma contamination - I received a mycoplasma positive culture and it spread into all my other cells cultures. Our lab usually sends the samples to a company for mycoplasma testing, but I know a few labs use PCR to detect mycoplasma. Could someone please share such a protocol and primer sequences with me? I would like to try it out so I can keep testing my cultures on my own, periodically.
Thanks,
Zankruti
You can readily detect contamination by a sudden change in your cells growth. Even if you detect Mycoplasma contamination, there is no way to eradicate it. Therefore, I strongly recommend to you to treat periodically a mycoplasma prevention agent in your cell culture rather than looking to decontaminate your cell culture.
Here is a set of nested primers:
For1 ACACCATGGGAGCTGGTAAT
Rev1 CTTCATCGACTTTCAGACCCAAGGCAT
For2 GTTCTTTGAAAACTGAAT
Rev2 GCATCCACCAAAAACTCT
As a template, I use 5ul of cell culture medium collected after a few days (3-4) of cell culture. PCR reaction in 50ul total, you can use any standard Taq polymerase.
PCR program:
94 - 5min
94 - 30s
55 - 30s
72 - 1min (30-35 cycles)
72 - 5min final extension
Take 0.5-1 ul of first PCR to the second PCR with the 2nd pair of primers. The bands you will see on agarose gel will vary because these primers detect different species of Mycoplasma. If the infection is strong you won't need the 2nd PCR, if it is weak nested PCR will detect it. For the exact bands size, search the protocol for TaKaRa PCR Mycoplasma Detection Set because these primers are copied from this protocol. They will range from 400 to 6oo bp 1st PCR, and 150-250 bp 2nd PCR.
Dear Zankruti Dave
you can find a set of primer and PCR protocol at the following link:
https://www.blogger.com/video.g?token=AD6v5dw7NqhRBr-g9xdXI151JBzQwSayjswhAYtYQ-Q_5Q6WPgZBgm_Mkqnq8LRgwlQ_5WZoyIlI6xYbi6Ha4XFXgxurdyOnJ5a3C7MicdqjrKBBrUX3sPrOUpcAaxm0VlTISU_AiQ
available on my simple scientific blog (ProteoCool)
good luck
Manuele
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Cell Biology
- Culture Cells
- Cell Line