I filtered 15 genes from Rosa hybrida degradome. I tried every possible field in primer3,5, ncbi, etc. May be there is problem in specifity. NCBI has no data for Roses, but we often match with the very similar genome Fragaria vesca. However, the specificity is mostly different from the Rose transcriptome database developed by Uni of Cornell.
What is your specific problem? Do not you know the sequence of your target genes? If you are knowing the sequences of the target genes, then you can design the primers to amplify the desired gene fragment.
You can use an online oligos property calculator tools. For example, here is the link to access one of the tools.
http://biotools.nubic.northwestern.edu/OligoCalc.html
yes sir Alemu, i know the target genes.. all are uploaded in the Rose Transcriptome database. I have tried every available software and online tool.. One thing i forgot to mention that the Tm of the primers is very much different after the primer designing company send it...i mean there is a bg difference in the Tm i got in the softwares and the Tm from the company.. I have studied that there are various formulas for calculating the Tm, so different softwares and tools may have different Tm values... but the problem is i select Tm not less than 58 degrees, while the companies send me around 50, thats a huge difference
Dear Muhammed,
The best and simple-minded formula for calculating the Tm is the '2+4 rule'!
Take 4°C for every G or C and 2°C for every A or T in your primer sequence and add them together.
A standard primer with 20 nucleotides (10 G or C and 10 A or T) will have a melting point of 60°C.
Good luck!
Best regards,
Thomas
Thanks Thomas.. I want to ask that what about selecting the Tm in the PCR, because if i calculate the Tm by this formula, and the company send me different Tm, so which one would be correct?
Dear Muhammed,
I always use the '2+4 rule' for my primer design.
The '2+4 rule' is a rule of thumb or empirical formula, but it works very well in the practice.
The other formulas are theoretical approaches.
Try to use standard primer (10 A/T and 10 G/C).
G/C rich primer are often unspecific.
Best regards,
Thomas
If you like, you can send me your new primer sequences, their internal location and at least a big part of the gene you want to amplify, for checking.
Best regards,
Thomas
you mean checking by softwares? i meant PCR checking, which Tm and cycles to select.. However, for checking by a software, i used to make primers from one tool like NCBI and checked it in primer3 and primer premier5, which usually gives false priming alert or other problems like dimers etc.
ARHL21705 sequence (264 bp): GAATGGGTTCAAGCTACAAAATGGCTGTTCCTGTACTTCACGTCCAGCTAATGGTGGTTACCAAGGCTAGAGGGGGTGCTGAGACTCAAGCTGATATTCGGTTCCTTCACTCTCTGCCCCTCCTTGAGATAATGGCGCGGCTCAACCCGACGTTGGATTCCATAGCTGCTTCCAATTGAGGGGGCTTGGAGGCTCCATTTTCTTTCACTGGAGTCTCCCTTTCTCATGGATAATGGCGTTGGCCAAGCCTATGTTGTATTCCTT
ARHL21705-F: TCCTGTACTTCACGTCCAGC
ARHL21705-R: GCCAACGCCATTATCCATGAG
ARHL21705 sequence (264 bp): GAATGGGTTCAAGCTACAAAATGGCTGTTCCTGTACTTCACGTCCAGCTAATGGTGGTTACCAAGGCTAGAGGGGGTGCTGAGACTCAAGCTGATATTCGGTTCCTTCACTCTCTGCCCCTCCTTGAGATAATGGCGCGGCTCAACCCGACGTTGGATTCCATAGCTGCTTCCAATTGAGGGGGCTTGGAGGCTCCATTTTCTTTCACTGGAGTCTCCCTTTCTCATGGATAATGGCGTTGGCCAAGCCTATGTTGTATTCCTT
ARHL21705-F: TCCTGTACTTCACGTCCAGC
ARHL21705-R: GCCAACGCCATTATCCATGAG
Dear Muhammad,
What is the difference between your both last contributions?
Is this your first try to establish a own PCR system?
I do not know, how specific your sequence and your primers are. Make BLAST search!
In your case , I would use the primer pair ARHL21705-F! and ARHL21705-R! (have a closer look to the appendix). With these primers (both should have a Tm of 60°C) try the annealing temperatures: 58, 60, 62 and 64°C.
Standard PCR conditiones:
95°C, 4 minutes, 1x
95°C, 1 min |
58, 60, 62 or 64°C, 1 min | 30x
72°C, 1 min |
72°C, 4 min, 1x
8°C, 'forever'
After this, use the best annealing temperatur you found.
If possible: sequence your amplicons!
Good luck!
Best regards,
Thomas
I have observed something. If the primers are in the "conserved domain", there are more chances of unspecific bands. Hence the primers must be in the region other than conserved domain. This CD can be seen in NCBI blast. 2ndly, the primers should be checked with different Tm, as this is the most important factor in any PCR. I would check it with +/- 3 degrees. The cycles should be modified after a try PCR first. You should increase the number of cycles if the bands are dim. But it depends upon other factors too. So best of luck