why I have different pcr product size , although the same primer pairs sequence were used in many previous study and result the same pcr product size, but by me I have a different pcr product size ?
I did PCR rxn with specific primers pair that result PCR product size 1720bp according to NCBI and also previous study , but in my result I GET 700bp pcr product size ?
what is the reason?
Firstly, have you tried replicating the previous assay exactly i.e. if possible using the same tube of template DNA/dNTP's/polymerase etc? Once you are able to reproduce the previous results using as many of the same components as possible you then have a control that you can run along side your own samples. Without a control you won't have any idea if the primers/template DNA/assay components are contaminated or whether the result you obtain is actually real.
Hi israa, recheck the template you have used for the PCR Reaction.Probably you used a cDNA for(intron less) amplifying your gene interst, where previously the template was genomic DNA. May be the lack of introns in your current template resulting amplification size of 700bp instead of 1720bp. And you keep the old template(previously used) as one of the control along with your current PCR reaction samples when you are setting the reaction for next time.
I did RT-PCR for S gene ( conserved sequence for Infectious bronchitis virus)
and I made the reaction many many times but the pcr product size were 700bp not 1720 bp as it should be
I do not know what is wrong ?
A quick NCBI seach shows that the S gene doesn't have any introns so that shouldn't be an issue. Perform the same PCR on the viral genomic DNA.....do you see the same result? Are you sure you generated a full length transcript? Perhaps design primers in overlapping 500 bp sections along the gene......is there a deletion?
IB is RNA VIRUS
and I did One step RT-PCR by specific primers for s1 gene
5 TGAAAACTGAACAAAAGACA 3
5 CATAACTAACATAAGGGCAA 3
that is conserved in all IB virus strains
DOES IT MEAN , IT CAN BE A NEW strain for example , deletion of 1000bp ? can that happen?
Hi, There is a couple of reasons you should check.
1- Purity of you culture that you extract DNA from it.
2- Use PCR water.
3- Use a good quality of MasterMix.
4- sometimes the annealing temp for the primer is problem you should try different temp
to find the good temp that gives you a good result, sometimes the non-perfect temp will lead to non-specific reaction for the primer.
If you need to characterise this particular isolate perhaps clone then sequence the fragment.
BUT perhaps you may need to look a bit more closely at your primers
Just quickly looking on NCBI I aligned the first two full genomic sequence I could find from two strains of IBV (KM586818 & EU817497, both hosted by chickens) and they are only 86 % similar. On EU817497 you can see where your primers should be but there are sequence differences. I wouldn't be suprised if your amplicon isn't from the S gene at all.
I would align as many of the genomic sequences from all the strains you can find and either design your primers to a region that IS definitely homologous amoung all the strains or design primers against all the different strains and see which one you have!!.....maybe.......
Hi,
Are you sure your primers are specific for your target? any other ammplification besides that 700bp? multiple bands?
read above also on the annealing temperature, what are the TMs of your primers and what annealing temperatures are you using?
The only way to be sure of what you are dealing with is to sequence it... purify the cDNA, sanger sequence it and nBLAST the resulting sequence
- Badges
- Science method