19 February 2021 5 7K Report

I constructed a synthetic DNA library (scFv, VH-VL orientation) with a 3' reporter and 8x histag. I cloned and expressed this gene following which I performed an ELISA. The ELISA results suggested binding activity of some of my scFvs against their target antigens. I sequenced the DNA of these 'binders' and the results were unexpected. I could detect the full and correct reading of the VL sequences but interestingly the upstream VH sequences had 2-3 stop codons interspersed and were not recognized as correct IgVHs by bioinformatics.

Can anyone please explain to me what may be going on here? A stop codon upstream should usually truncate the protein at that point but the ribosome seem to have read through the stop codons.

I guess what I am interested in knowing is whether the VH is aberrant and non-functional and whether the binding activity I observed with ELISA was contributed solely by functional light chain, VL.

Here is one of those sequences (VH, linker and lambda VL).

CCATG GCC GAGGTGCAGCTGTTGGAGTCCTGGCCGCAGTGAGGAAGGGAACTGACTGCCGAGGCCGGAGGGCAGCCGGCCTGCCGAGGGGAACAGCTGGATCTGGGTCCAGGTCATGGGTAGGTGGGCGCGCAGGCAGACTTTCGTGATGTTGTGCACTTGAGGTGTTGTGCTGGACTTCCACAGCAGACAGGAAGGGTGAACAGAGCAGCCCTTCAGAGAGAAGCACTGGGCAGTCACAGGGATTTGAGGGAGGGTGGAGGACACCCTGCAAGCCCTGCGTGGCCACCAACAGGCAGCGCCCTGCAGCAAGGGGGCCACCGTCTCCTCA

GCCTCCACCGGATCCGGTTCTGGTAGTGGTGCTACTTCTGGATCC

TCCTCTGAGCTGACTCAGGACCCTGCTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAAAAACCGGCCCTCAGGGATCCCAGACCGATTCTCTGGCTCCAGGTCAGGAACTACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAAGAGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTA

PS: I sequenced 2x with different primers and in forward and reverse.

Thank you all in advance.

More Randy Chance's questions See All
Similar questions and discussions