I am currently in early stages of doing a study of DM foot complications. I would like to use the Q-DFD tool for data collection. How can I access it?

22 April 2023 0 8K Report

Study population - patients attending surgery outpatient clinic with DM foot disease.

Aim - determine patterns of presentation of DM foot disease in a sub-urban hospital.

Badges
Science topic

More Dennis Nyambane's questions See All

How to carry out micro preparation of Zn-2 (Zamak 2) sample surfaces?

I am currently struggling to achieve a good surface finish on mounted Zn-2 samples. Both grinding and polishing (with SiC, silica and diamond) resulted in embedding of the grinding/polishing media...

11 June 2024 2,055 0 View

FFPE mouse femurs appear to have internal bubbles?

I am wondering if this is a technical issue that occured during processing. I have murine femurs that were decalcified in 15% EDTA over 2 weeks and then processed and I embedded them into FFPE....

02 April 2024 6,382 2 View

Is it necessary to include an FMO for 7-AAD dye in your Flow Cytometry experiment? If not, why?

I'm optimizing a flow cytometer experiment and one of my three stains is a 7-AAD Live/Dead stain. The other stains in my experiment are staining for CD34+ and CD45+ cells. Is it necessary to...

01 April 2024 3,060 0 View

What is best way to get lowest adsorption site at subsurface of high entropy alloys?

I am currently studying diffusion of oxygen in high entropy alloys. I want to calculate the activation energy from an adsorption site on the surface to the subsurface. I placed the oxygen atom...

26 March 2024 3,268 0 View

Examples of gender norms that affect men and women's participation in agriculture?

It is a course unit called gender and social economic issues in development ARX 1201

07 January 2024 365 0 View

Is it necessary to to conduct independent simple regressions for a multivariate regression model or this can be derived from the multiple regres?

The objective here is to determine factor sensitivities or slope coefficients in a multiple ols regression model.

17 August 2023 7,825 5 View

Does anyone had problems installing Cytoscape in Ubuntu 22.04.2 LTS?

I am trying to install Cytoscape in Ubuntu 22.04. I followed the instructions on the official website and installed Java 11, 17 and 18. None seems to work. I had this error every time: Error:...

30 May 2023 9,889 2 View

Why is it that when I open a structure and I select atoms in Vesta it crashes immediately?

I am trying to work on a structure in Vesta. But after opening, it crashes when I select atoms to delete. Any help would be deeply appreciated

07 March 2023 5,805 4 View

Working primers for human NPC1 and TrkB qPCR?

For one of our experiments we are planning to run a qPCR on cDNA from human samples. In our first test, we found that our primers for TrkB (forward: ACAGTCAGCTCAAGCCAGACAC, reverse:...

24 January 2023 4,508 3 View

Can standardize test be a data collection tools for descriptive study?

Good day scholars, I am doing a descriptive study and want to administer a standardize test, is it possible?

21 September 2022 6,517 1 View

How can reinforcement learning algorithms be effectively applied to study decision-making processes in neuroscience?

I am interested in exploring the intersection of neuroscience and AI, particularly through reinforcement learning for understanding decision-making in the brain. I also want to integrate...

17 July 2024 1,225 0 View

How do the complex dynamics of the oral microbiome interact with the host immune system affect periodontal disease development and treatment response?

This research question explores the complex dynamics of interactions between the oral microbiome and the host immune system, particularly in the development and treatment response of periodontal...

09 July 2024 7,922 1 View

What is the association and mechanism between bacterial diversity in the oral microenvironment and clinical manifestations of periodontal disease?

This research question explores the complex relationship between bacterial diversity in the oral microenvironment and the clinical manifestations of periodontal disease. The oral microenvironment...

09 July 2024 6,210 1 View

What is the current status of augmented learning in robotic surgery?

I would like to perform a literature review at this time on augmented learning and learning augmented algorithms to enhance performance-guided surgery

06 July 2024 246 1 View

Has anyone used the new E1 Clip tip digital pipettes?

We just purchased a multichannel and a single channel E1 Clip tip pipettes. In our first attempt to use them for an experiment they are not dispensing accurately? The rep told me that...

01 July 2024 1,983 0 View

What are the primary indications for choosing neuraxial anesthesia over general anesthesia in surgical procedures?

The Evolution and Application of Spinal Anesthesia: Techniqu... What are the primary indications for choosing neuraxial anesthesia over general anesthesia in surgical procedures?

27 June 2024 5,763 1 View

How to select drugs for repurposing?

Hello everyone, so I am searching for ways to find the method for picking the right drug for repurposing. This repurposing is for existing and new diseases. This is very important, please help.

23 June 2024 7,730 2 View

Use of agency vs. google-translation for translating non-english qualitative data?

Hi, As part of a miltilevel study examining the impact of steroid toxicity in patients with different rheumatic diseases (see here: https://vasup.ndorms.ox.ac.uk/) we collected data from the UK...

17 June 2024 4,016 4 View

How can we train multi-modal CLIP architecture to generate images using Prompt ?

Can we even make changes to CLIP Model architecture such that it can be used as an image generator from prompts ?

16 June 2024 320 0 View

Have pathomorphological studies of the lungs been performed in patients with desminopathy?

It is known that patients with desminopathy often die from pneumonia. Have pathomorphological studies of the lungs been performed in patients with desminopathy?

15 June 2024 1,355 7 View