I am trying to determine RNA level of IL-25 in human samples, including hepatocellular carcinoma tissue and cell lines. To my disappointment, all of them were negative, which was different from the antibody staining experiments (western blotting and immunofluorescence).
Could someone please give me some suggestions about positive control of IL-25 in human samples? Thank you!
I checked your primers against Dinamelt and whilst some are not ideal, they should work. Also amplicon folding is ok, although again the primers map to secondary structures. Regardless, these primers should amplify any IL-25 mRNA present. Primer pair 1 is not exon spanning, so should amplify DNA. This means you ought to pick up something when you amplify non-DNase-treated samples.
The amplicons are a tad long at 160-200 bp. Beacon designer suggests GAAGATGGACCCCTCAAC and TTCAAGTCTCTGTCCAACTC, which would generate a 65 bp amplicon spanning an exon junction.
I'm afraid I might need a little more information - what method are you using to detect the mRNA in your tissues/cell lines? RT-PCR, Northern Blot, FISH etc.? In addition, are you sure the technique is working - can you definitely quantify other transcripts and specifically can't detect IL-25 mRNA or is it that you can't pick up any transcripts?
if you're sure of the results on protein expression, first of all test your conditions for detecting mRNA.
1) are you using efficient primer pairs? are primers specific? did you test them for efficiency, self-dimerization etc?
2) did you analyze mRNA sequence? did you analyze the occurence of splice variants that could confuse the correct functioning of primers?
3) are you 100% sure of your retrotranscription procedure? and of the quality of your RNA?
I would suggest extracting RNA from whole PBMC for your positive control, as il25 is expressed in T cells. Also, how sure are you about the specificity of your immunostaining approaches?
Did you use RT-qPCR and if so, can you let us have the primer sequences? If you were not using RT-qPCR, you might want to try it.
Thank you very much for all of your excellent suggestions!
@Daniel Scott
General RT-PCR and RT-qPCR were both used to detect IL-25. I am sure that the technique is working because we can pick up actin mRNA.
@Amilcare Barca
Only two splice variants are reported currently, my primers can pick up both of them. I think whether there are other splice variants according to the protein migrated at about 30 kD, not corresponding to the predicted size(about 17 kD for monomer).
@Kristofor Ellestad
I will try it with PBMC, But I consider that PBMC may be stimulated with some factors. For the specificity of my immunostaining results, I am not very sure, because we can only found bands that were not corresponding to the predicted size!
@Stephen Bustin
I used RT-qPCR, I designed two pairs of primers as follows:
1. CGCCACCCAGAGTCCTGTAG GGGAGCCTGTCTGTAGGCTG
2. CAGTCAGCCTGCTTCCAC ATCCCAGTTTCTCACTCCAC
I checked your primers against Dinamelt and whilst some are not ideal, they should work. Also amplicon folding is ok, although again the primers map to secondary structures. Regardless, these primers should amplify any IL-25 mRNA present. Primer pair 1 is not exon spanning, so should amplify DNA. This means you ought to pick up something when you amplify non-DNase-treated samples.
The amplicons are a tad long at 160-200 bp. Beacon designer suggests GAAGATGGACCCCTCAAC and TTCAAGTCTCTGTCCAACTC, which would generate a 65 bp amplicon spanning an exon junction.
Thank you Dr. Stephen Bustin for your sincere replies. I will make a try!
Renal cell carcinoma cell lines are good positive control for IL25 detection
such as T293 that IL25 purify from supernatant of this line
- Badges
- Science topic
- Similar topics
- Biological Science
- Molecular Biology
- Biomolecules
- Nucleic Acids
- RNA