I am developing a multiplex qPCR assay for GMO detection and am considering using an oligoset originally designed for the 23S rRNA gene to detect a synthetic DNA template as an internal control (IC) in the Cy5 channel, while my target sequences are detected in the FAM, VIC, and ROX channels.

The internal control is exogenous and is intended to be added after DNA extraction, just before qPCR. It is not an extraction control, but rather an inhibition control, intended to monitor potential PCR inhibition in the samples.

My main questions are:

  • Can an oligoset originally designed for the 23S rRNA gene, repurposed to detect a synthetic template, function effectively as an IC in the Cy5 channel alongside targets in FAM, VIC, and ROX?
  • Could this oligoset amplify any sequences present in the sample DNA, rather than exclusively detecting the synthetic template?
  • Is there anything else I need aside from the following components?
    • IC Template: TACTCCGGGGATAACAGGCCAGCTGCCAGTCCTCACTCGAACTGGCCGTCTACAGTCTTCCAGGACGTCGTGAGACAGTTCGG
    • Forward Primer: TACYCYGGGGATAACAGG
    • Reverse Primer: CCGAACTGTCTCACGACG
    • Probe: Cy5-TTGGCACCTCGATGTCGG-BHQ1

    This is my first time designing an internal control myself, so I would greatly appreciate any insights, experiences, or best practices regarding synthetic IC templates in multiplex qPCR.

    Thank you in advance for your help!

    Similar questions and discussions