I have been trying to identify E. coli isolates by PCR. I have read a paper then found out about the uidA gene region to identify E. coli specifically (Article PCR and blood culture of Escherichia coli bacteremia in rats
). I used the first primer pair to run PCR for amplifying the uidA region. The PCR product is expected to be 486 bp. Three of 5 samples (S1, S3 and S5) showed the expected bands on the gel. However, 1 of them (S2) showed a band of unexpected size. I attached the gel picture.The first primer pair for uidA was used : P1: ATCACCGTGGTGACGCATGTCGC and
P2: CACCACGATGCCATGTTCATCTGC
The PCR was performed: 1 cycle of 950C for 5 min, 35 cycles of 950C for 30 sec, 550C for 30 sec, 720C for 1 min, and a final elongation at 720C for 5 min.
Should the sample with unexpected size (S2) be considered as E. coli? Could you please give advice on this? I greatly appreciate all your help.
Thank you very much.
Thu.
The size difference between the two amplimers is about 500bp. This is a large difference and I expect that this is more likely to be an amplification artifact rather than an insertion but really the only way to say what this amplimer is involves sequencing the larger amplimer and Blast ing the result to see if there is homology with the expected amplimer
Thank you very much, Paul. I'm trying to check as you advised. It would be very helpful for further runs. Kind regards, Thu.
Thu Minh Ngoc Vu - Hi,
Hi,
I can see some problems in your above mentioned Primers. They seem to be self-complementarity, which you should avoid while designing the primers.
Use this link to find the details about your primers.
http://biotools.nubic.northwestern.edu/OligoCalc.html
Also your primer actual Tm are quite high, and the PCR annealing temperature is low (in the PCR reaction setting you have mentioned above). Please try to optimize the PCR setting accordingly, and try the reaction with another set of primers.
Good luck,
regards,
Mradul
- Badges
- Science method