Ask for help about wannier90, hopping matrix elements are not complex conjugate?

Dear All, I calculate band structure and hopping matrix of monolayer Graphene by using wannier90-2.0.1. There are two atoms in one unit cell, the following is input information : INCAR :...

26 February 2020 4,885 1 View

How to calibrate a T/C CO2 sensor in an air-jacketed CO2 incubator without an independent CO2 sensor?

I have an air-jacketed CO2 incubator and I need to calibrate its thermal conductivity CO2 sensor. However, I do not have a CO2 sensor that is independent of the incubator to measure the CO2...

31 January 2020 8,758 1 View

What is a good procedure to identify if the CO2 incubator is the source of contamination in my cell cultures?

I have read some vague descriptions about how to screen the CO2 incubator as the source of contamination. I saw recommendations to leave a plate of cell culture media in the incubator and view it...

12 January 2020 8,639 2 View

Have problems in insert sgRNA into lenticrispr v2 vector?

my oligo forward: 5`->3`:CACCGCTAGACACGGAATCATGCCG reverse 5`->3`:AAACCGGCATGATTCCGTGTCTAGC I done all things stickily followed the zhanglab protocol-Target Guide Sequence Cloning Protocol,...

28 December 2018 4,592 3 View

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

How to measure the perceived contradiction of "need certain resource yet cannot acquire it"?

28 March 2018 6,378 2 View

Can I run a multiple regression with 150 cases altogether with hormones as independent variables to predict birth weight?

12 October 2016 6,081 4 View

Is there a more efficient method to calculate the surface Green function except through transfer-matrix?

15 December 2015 2,872 4 View

What is the proper stimulation point (dosage and time) for VSMC proliferation?

20 February 2015 2,729 1 View

How do you distinguish between human and mouse cells in mouse sections?

Does anyone know good antibodies to distinguish between human epithelial cell and mouse cells in mouse liver sections by IHC staining? Thank you for your answers.

16 November 2014 4,670 3 View

Do you starve PBMCs before LPS stimulation?

I'm maintaining mouse PBMCs in 10% FBS for a LPS stimulation experiment. I'm going to plate the cells in 96-well plate and treat them with LPS for ELISA. Just wonder if you guys starve the cells...

07 November 2014 9,702 5 View

Could you recommend any books about Number Theory?

Beginner level books. High level books. Analytical Number Theory. Algebraic Number Theory. Combinatorical Number Theory. Books about partitions. Books about primes.

03 March 2021 7,174 5 View

What kind of intervention will be relevant to increase motivation among young sport trainees?

Any suggestion on what book to read is also welcome.

03 March 2021 1,646 4 View

How the parameters (such as Mw, Chemical bonds, polymer bland and so on) affect the mechanic property of polymer (such as storage, loss modulus) ?

Anyone can recommend any books on such topics? Thanks in advance.

02 March 2021 8,457 2 View

No title

02 March 2021 3,060 3 View

I am interested in medicinal chemistry field, which books are highly recommended to learn from?

I am at the beginner level in drug design and drug discovery, and I am interested to learn more about this field. Which books are highly recommended to start from and gives me all essential...

02 March 2021 8,437 2 View

Please suggest a good text book for "Research Methodology in Life Sciences". Which book would be good for PhD Scholars?

Please provide Book Title and author name

02 March 2021 9,059 3 View

Which is a lucid standard comprehensive book to guide on psychological scale construction and its standardization?

02 March 2021 7,082 3 View

What element is driving the different slop in the low frequency tail?

My study consists simple corrosion inhibitors in salty brine. Right now I just fit my circuit with randles with CPE. Just wondering how the slop can given more info of the experiment. Or any...

01 March 2021 6,474 3 View

Is there any rich, publicly available English literary corpus?

Hi everyone. I am looking for a rich corpus in English literature, a one which includes literary prose ( e.g., novels or short stories) . can anyone propose a good one? Best regards Fatemeh

01 March 2021 1,970 2 View

Genome-wide gene identification protocol ?

Is there any book chapter/book, webpage or research article available to understand genome-wide gene identification?

28 February 2021 8,095 1 View