I would like to design a double strand siRNA. I used the two different server consist of “siDirect” and “invivogen” to design the siRNA. These servers design it with nucleobases “T”. While the siRNA must has a nucleobases “U”.
1. Can I change “T” to “U” and design the siRNA? For example: the sequence in server is: 5'- GGGTATGATAACCGGGAGAT -3' then I convert this to: 5'- GGGUAUGAUAACCGGGAGAU -3'
2. This sequence “5'- GGGTATGATAACCGGGAGAT -3'” is a part of the mouse BCL2 mRNA that can be found in NCBI nucleotide databank with accession number of NM_009741.5. Is this sequence related to the Sense sequence or the antisense sequence?
3. Can I add two overhang “T” in the 3’ end of this sequence or adding one nucleobases “T” is enough? (Because the sequence itself has a "T" in its own 3’ end : 5'- GGGTATGATAACCGGGAGAT -3')
With regards
Hi Zahra,
first - it is best to look into literature if you can find published siRNA that works for your gene... because a lot of siRNA does ´nt work...
In the NCBI databank you have the coding sequence (sense) and the siRNA strand which is doing silencing is antisense... The antisense strand should have overhang (does not have to be T... you can have for example two last nucleotides that match your sequence but as deoxynucleotides...) ... You can introduce even some mispairing (1-2) in the middle of your sense strand of siRNA to increase seeding capability of your antisense strand... According to the asymmetry rule, the strand with the less stably paired 5′ end is finally incorporated into the RISC and becomes the guide strand
You can switch T for U in the sequence... You should design more than one...
Best
Jakub
Hi Jakub,
Thank you very much
Sure. Therefore, in your opinion am I going to order the Sense strand with the nucleobase “U” throughout the strand and two overhang nucleotide at the 3’ end of this? And can I just designing the siRNA with 3’ overhang at the end of sense strand (or both at the 3’ end of sense and antisense strand)?
With regards
Hi Zahra,
the strand which is imporant for silencing is antisense strand, not sense strand (sense strand = sequence of mRNA....). You should have overhangs on both strands (not so important the sequence of overhangs) or you can have overhangs only on antisense strand to increase the probability of loading preferentially antisense strand to RISC complex (due to asymetry of siRNA molecule)...
I have send you the 4 examples of siRNA (in supplement) that nicely worked for me ...
Good luck
Jakub