I am doing qPCR assay targeting intI1 genes, with some waste water treatment plant DNA samples. I used the primer pairs HS463a (CTGGATTTCGATCACGGCACG), HS464 (ACATGCGTGTAAATCATCGTCG), IntI1F165 (CGAACGAGTGGCGGAGGGTG), IntI1R476 (TACCCGAGAGCTTGGCACCCA), IntI1-LC5 (GATCGGTCGAATGCGTGT), IntI1-LC1 (GCCTTGATGTTACCCGAGAG).
According to the published informations, HS463a-HS464 amplifies both clinical and environmental class 1 integrons. IntI1F165-IntI1R476 only amplifies the clinical version.
IntI1LC1-IntI1LC5 amplifies clinical IntI1, but I was wondering if it can amplify the environmental version too. Anyone tried this primer pairs before and can answer this question?
Also, for further analysis I have to choose one primer pair out of these three. what are the factors I have to consider to select the best one?
the standard curves look good for all three primers. But the recorded copy numbers for the same unknown samples are different using each primer pair.
Thank you!
For my idea try to test both the primer and after in function if they work in PCR you pass to perform the qPCR. Or another thing is to write yourself the primer.
Giorgia Pertile they worked well in PCR, I'm doing qPCR now, where I have good standard curves for these primer pairs too.
By testing some unknown DNA samples I have to decide which primer to choose for future analysis.
for some unknown samples, one primer pair detect more dsDNA, while for some other unknown samples, another primer pairs detect more. I got confused in this case.
Hi,
Have you calculated the efficiency for both sets of primers?? With that, you will have a quantitative criterium that could help you decide which one to use. Standard curves may look fine and quite similar but it will be unlikely to obtain the exact same value of efficiency for both primers. However, if they show very similar and good efficiencies (i.e. higher than 1.8) then theoretically, both are equally good and you can choose either.
Hope to be of help,
Good luck!
Annia
Annia Alba
Thank you so much.
May I ask how can I calculate the primers efficiency? I know my PCR efficiencies are the slopes of the standard curves (~-3.7). I didn't understand the value 1.8....
can we decide based on their detection limits in environmental samples?? Can you explain this please.
1.) Efficiency of the standard curve = [10(-1/slope)] - 1
2.) Exponential amplification PCR efficiency (E_AMP) = 10(-1/slope)
(e.g., if Efficiency of the standard curve is 0.83 or 83%, then E_AMP = 1.83)
3.) Also, slope = -1/log10(E_AMP)
The EAMP values that are the "E" values used for fold-change calculations.
See also https://toptipbio.com/calculate-primer-efficiencies/ it hasa link to an online calculator.
As others said above, the only way to determine if you can use a particular pair of primers for qPCR is to calculate the efficiency. Just in case you need more information about what is needed to publish, this manuscript is a classic and a must-read.
Article The MIQE Guidelines: minimum Information for Publication of ...
Hi, Termeh Hesam Mahmoudinejad.
May I ask you If you're looking at the amount (DNA concentration) of sample you're using? I am assuming you're using the same amount to compare your results. If not, maybe it's giving you these awkward results.
Wastewater has lots of different inhibitors. So, I would do the tests using a one typical sample or a mixed one as your control, in order to check if differences are based on reaction and not on sample inhibitor amounts. Was the idea clear?
Hope it helps you!
- Badges
- Science method