6 Questions 20 Answers 0 Followers
Questions related from Termeh Hesam Mahmoudinejad
I'm doing qPCR targeting 16s rRNA with the primers 337F and 518R. The standard curve looks fine. The problem is the melting peak of the environmental samples of unknown bacterial composition. They...
05 May 2019 8,810 17 View
I did the plasmid extraction, and ran the PCR with my primers... Then, I did the magnetic bead purification to purify the PCR product. In the attached picture you can see smearing in the lane on...
04 April 2019 9,452 8 View
I did a PCR assay and the PCR product is purified by magnetic bead purification. By running the PCR product on TAE agarose gel, I got the clear desired amplicon. But when I tried the purified...
03 March 2019 6,296 13 View
I am doing qPCR assay targeting intI1 genes, with some waste water treatment plant DNA samples. I used the primer pairs HS463a (CTGGATTTCGATCACGGCACG), HS464 (ACATGCGTGTAAATCATCGTCG), IntI1F165...
02 February 2019 2,702 9 View
Hello, I’m beginner in doing PCR assay. So, the question is very basic. I did a pcr test and after runing the gel electrophoresis, I saw the target gene got amplified. I was told to use the DNA...
01 January 1970 1,809 5 View
The 16s rRNA gene is quantified in some surface water samples. But there was always amplification in the no template controls (which contain nuclease free water instead of DNA). The problem is not...
01 January 1970 5,954 6 View