How to analyze PLA slides on Zeiss spinning disk confocal only in the nuclei?

09 September 2020 1 8K Report

Hi!

I did an experiment involving the Proximity Ligation in situ assay (PLA) and I analyzed my samples with a confocal microscope. I have two channel: one DAPI for the nuclei and one Texas Red for the dots (they appear only when the two targets of interest interact). I need to know how many dots i have inside the nucleus before and after treatment (knowing that I have also dots in the cytoplasm compartment). Basically, I would like to know if anyone knows a way to count dots in a 3D configuration and be sure that those dots are inside the nuclei and not outside (which I can't determine on a 2D pictures because the dots might be over the nuclei in this plan).

Thank you

Romain Pacaud

Hi Maeva! Thanks for your answer!

I actually figured out a way to do it through Fiji (not the best but better than a macro that i don't trust, since effectively, I don't know so much about macro-coding). I'm gonna try Volocity then, it looks like a good software for my purpose.

Thank you so much and take care!

Romain

Badges
Science topic

Similar topics
Mathematics
Algebra
Matrix

More Romain Pacaud's questions See All

Fish eggs ID?

Any idea of the species? Catch in may, near roscoff in brittany, No oil globule, size 1.2mm The specimen is well marked with melanophore, and pectoral fins are already pigmented (as seen on...

26 May 2024 7,624 0 View

Which brand of hand vacuum pump do you recommend for suspending particulate organic matter (SPOM) filtration?

I'm looking for a durable and user-friendly system to filter SPOM while on a boat in the field. The last one I used was the Mityvac Hand Vacuum Pump, but the plastic handle broke after intensive...

17 March 2024 3,877 0 View

Why an antibody can recognize a recombinant protein but not the endogenous protein in a western blot ?

I did a western blot with 25ug of protein lysate. As control, i used the recombinant protein and cell who not express my protein. The first antibody (rabbit polyclonal) recognize only the...

14 June 2023 7,853 3 View

Quelle est la meilleur façon de simuler du radium 226 à l'équilibre sur GATE?

Dans le cadre d'un projet d'étude dosimétrique, je me dois d’effectuer une simulation de radium 226 à l'équilibre. Afin d'utiliser au mieux le logiciel GATE, et d’interpréter correctement les...

29 May 2023 8,462 0 View

Why our copy number analysis fluctuates with Quantibrite PE beads?

Hi, I have a question about FACS and copy number estimation of a protein of interest. We have a protein of interest (on the membrane surface) that we are studying and we have an antibody coupled...

21 February 2023 1,931 0 View

Culture medium SGM17 fluoresce (GFP)?

Hello everyone, I am looking to study the fluorescence intensity of GFP in a GRAM positive bacterium. The culture medium is M17+sucrose+glucose. Does this medium fluoresce in the GFP wavelengths?...

14 February 2022 7,195 2 View

What do I still have multiple bands after isolating each bands through Gel extraction ?

Hi, I'm trying to develop a KO cell line from an established cancer cell line. My gene of interest is present in 3 copies in this cell line. I'm using a multi-sgRNAs technique to increase my...

01 December 2021 8,770 5 View

SMAP L4 Carbon product: suitable for all ecosystems?

Hi there, Working on C fluxes and stocks quantification, I would like to know if SMAP L4 Carbon products are reliable enough for other ecosystems than boreal forests (GPP, NEE, RH, SOC). Indeed,...

20 July 2021 7,251 0 View

What is the trouble with my base editing ?

Hi, I'm trying to do a base editing. My target gene is MYBBP3A, the guide RNA I'm using is ACTCGCGACTGTGCTTCAAT and I cloned it in the pLentiguide-puro (Addgene 52963). I used this guide because...

27 June 2021 2,139 7 View

Why my transformation does not work after successful ligation ?

Hello everyone, I'm really not familiar with molecular biology protocols, and I try to obtain several constructs of my protein by doing PCRs and ligation starting from a WT-plasmid. I...

13 May 2021 2,871 7 View

Does anyone know why this article is republished using the fake address. Is it about stealing my patent?

This article is mine. It was republished by unknown person using an address (Wilson N Jones Regional Center, Sherman Texas USA. I have a patent.

10 August 2024 7,528 5 View

What is the difference between alluvial and fluvial?

I have made an unpleasant discovery that I seemed to use these terms incorrectly. 'Alluvial' seems to mean "out of the river channel", flood-plain' etc. While all these cross-bedded...

15 July 2024 2,073 3 View

How to add channel doping variation in sentaurus tcad to see its effect on transfer characteristics of mosfet?

I am getting trouble in studying the effect of channel doping variation in forksheet structure for p and nmos.

08 July 2024 2,074 0 View

• How can scientists ensure their research findings are effectively communicated to the broader public?

Effective public communication of research findings requires a combination of skills, including translating technical information, crafting engaging narratives, leveraging multimedia, and actively...

01 July 2024 1,330 2 View

How to converge PEMFC in Ansys Fluent?

I am simulating 1 cell of PEM with an area of 50 cm². The mesh has an orthogonality of 0.2 for the channels and bipoar plates (polyhedra) and a quality of 1 for the active zones (hexagonal). The...

26 June 2024 2,358 0 View

Are the messages transmitted in classical channel between participants in quantum cryptographic protocols free from being blocked or delayed ?

In quantum cryptographic protocols, participants typically share both a quantum channel and a classical authenticated channel. Authenticated channels ensure that messages come from legitimate...

22 June 2024 7,074 3 View

How to write literature review?

i want to write literature review on the topic " production of 3d PLA filament"

19 June 2024 1,712 2 View

How does power allocation strategy in NOMA for 5G networks?

How does power allocation strategy in NOMA for 5G networks impact the trade-off between system capacity and user fairness, particularly for users with varying channel conditions?

18 June 2024 4,592 2 View

How to reduce the permeability of pdms?

I want to trap fluid (water..) in the PDMS channel for a long time. After a short period, the channels become empty of fluid. Is there a way to reduce the permeability of PDMS?

17 June 2024 2,703 4 View

Does variations in the number of lattice nodes affect lift and drag calculation in Lattice Boltzmann Method?

Dear colleagues, I have spent a few weeks trying to figure this problem out with no success, so that I post this question here. First of all, I have to say I am new to LBM method. I am working...

11 June 2024 1,084 3 View