3'-------------------------------------------------------------------------------5'

Primer 1 3'------

Primer 2 (~20nt before and after insert) ------XXXX------

Primer 3 (reverse comp of primer 2 ) ------XXXX------

Primer 4 (reverse comp) ---------5'

Set up PCR with primer 1 and 2 + template

Set up PCR with primer 3 and 4 + template

Gel purify fragments (not always necessary, but will help a lot)

Set up PCR with your two gel extracted fragments + Primer 1 and 4.

You should now have your product with 4 nts changed.

As for primer design, Primer 1/4 would be regular sized amplification primers (14-20nt usually). For primers 3 and 4, they will be reverse complements of one another and the overlap on each side of your 4nt change should be about 16-22nt (Tm of each overlap should individually be similar to primer 1 and 4.

I hope that the picture above I tried to make looks ok, but assuming it doesn't, this like give a pretty good explanation of what to do. This method can be used to delete a portion of a construct or to insert a mutation, like you are doing. Let me know if there is anything I can explain more clearly! (Also, this can be done for fairly large replacements and insertions, so 4nt is no problem)

http://www.biotechniques.com/BiotechniquesJournal/2013/March/Gene-Splicing-by-Overlap-Extension-Tailor-Made-Genes-Using-the-Polymerase-Chain-Reaction/biotechniques-341027.html

It is hard to show here with since this text box wont show multiple spaces, but below I made an image that hopefully demonstrates that I made my example correctly based of your instructions?

I put the picture on my server to show what I mean:

http://www.xcellwebdesign.com/mutantprimers.jpg

The x's show the mutant nucleotides I would introduce, they wouldn't bind onto the template strand but the other 20 nts of the primer should to allow the primer to anneal. I plan to get the primers so that the Tm is 62C.

First, I think i found a site that explains the process more clearly (http://openwetware.org/wiki/PCR_Overlap_Extension). The only difference being that you are using the same template, you are just mutating 4nt between the two ends of your construct.

Overall, I think that you have it correct. I noticed that my example didn't look very clear, but I did not have time to fix it, so sorry about that. Although this can be used to attached two different sequences together, it is useful for making mutations. To give an example, the primers that I used to mutate GAGTAGCAGATGATCTAGGCCTGACTCCTGAACAAAGAACTGAGGTCAC to

GAGTAGCAGATGATCTAGGCCTGgaaCCTGAACAAAGAACTGAGGTCAC

were

GAGTAGCAGATGATCTAGGCCTGgaaCCTGAACAAAGAACTGAGGTCAC

and

GTGACCTCAGTTCTTTGTTCAGGttcCAGGCCTAGATCATCTGCTACTC

As for the Tms, it should not matter as much for this. With mutagenesis you have to use the Tms of your overlap flanking the mutation, because the mutation itself with affects the binding. After a few cycles this will no longer matter as much, but having a high Tm for the full length primer is fine.

I also wanted to add that if you don't mind spending a little more and your plasmid is not very large (>10kb) this kit works very well for introducing mutations (Agilent QuickChange): http://www.genomics.agilent.com/en/product.jsp?cid=AG-PT-175&tabId=AG-PR-1162&_requestid=1437611

I agree with James, I always used QuickChange for this kind of mutations. You would need two primers complementary to each other. The center of each primer contain your mutation and on both sides you have equal by melting temperature sequences. Consider each side as independent primer and choose the sequence (length since the sequence is predetermined by your plasmid) by melting temp calculator. The second primer is completely complementary.

Better not to exceed 55 nt total, melting temp does not have to be very high, 40-45C is OK. If higher and primers longer could be incorporation of multiple primers.

Then you do PCR like suggested only melting temp from your calculation, transform into XLBlue1 and next morning have colonies of ready to use plasmid (of course need to purify first!).

Good luck,

Galina

Hello,

I also forgot to mention two important points:

first - since it's a long PCR, better use high fidelity polymerases such as Vent or Pfu, I prefer Vent since it's faster 1 kb/min.

Also very important - after PCR before transfornation really carefully digest with DpnI endonuclease, it will remove the template (unmutated DNA). Add directly to mix, vortex and spin few times, maybe add more after 30 min incubation - it will really save time on selection of good clones. If done right all the clones you'll get (even only 1) will be with mutation.

Galina

Thanks James and Galina!

I am first just going to use the primers for crossover pcr (SOE) since the primers cost around $7 each and the agilent kit is over $300.

So I am designing the primers like you said where I mutate my 4bp sequence and have about 18-27 nt on each side to make the Tm about 59-62C for each side of the 4 nt mutation (which is the same Tm as my forward and reverse primers for the WT 3' UTR). Hopefully that will allow me to anneal at 55-57C and all will be well.

The mutations I made were so the miRNA nucleotides that bind the 3' UTR sequence would then bind purine to purine, pyrimidine to pyrimidine. This should effectively prevent the miRNA from binding onto my 3' UTR.

miRNA: ACTG

miRNA binding WT: TGAC

miRNA binding mutant: GTCA

Hi Nathan

Just to let you know that you do not need to buy the kit, it's just a regular PCR, so you need primers, any good polymerase and everything else like in normal PCR - dNTPs, etc. Also I added Mg to 3-4 mM (in regular polymerase buffer it's 2 mM). All the reagents you have would work with this method.

Good luck either way,

Galina

Hi Nathan, there is another way to do mutagenesis. It was developed in our lab and I have used it several times. It works really good for mutagenesis and you dont have to spend a lot of money. Here is the link.

https://www.researchgate.net/publication/237093686_SOMA_A_Single_Oligonucleotide_Mutagenesis_and_Cloning_Approach?ev=prf_pub

All the best for your mutagenesis.

Article SOMA: A Single Oligonucleotide Mutagenesis and Cloning Approach

Hi Nathan,

Just wondering how big is the insert you would like to change ( I mean the size of the fragment between two restriction sites ). You could just order dsDNA fragment up to 750bp from IDT, digest it and clone.

Easy and cheap. (about $100).

@Sergey - The fragment is 1003 bp. I assume that is too big?

@Sanjeev - I will definitely check that method out! I could put the normal 3' UTR into the plasmid then mutate it.

Hi Nathan,

Maybe you could find unique digestion sites that are closer to your mutation?

The best way as James and Galina have mentioned design primers with your mutation so that when you do per you can introduce the mutation. Best of luck Nathan

I have always had great luck with the QuickChange in vitro mutagenesis kit.

http://web.physics.ucsb.edu/~deborah/pro/pro_pdf/Stratagene%20QuikChange.pdf